Incidental Mutation 'R4230:Spag6'
ID320765
Institutional Source Beutler Lab
Gene Symbol Spag6
Ensembl Gene ENSMUSG00000037708
Gene Namesperm associated antigen 6
SynonymsBC061194, Spag6l
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18694032-18750413 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 18715638 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095132] [ENSMUST00000095132] [ENSMUST00000173763] [ENSMUST00000173763]
Predicted Effect probably null
Transcript: ENSMUST00000095132
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000095132
SMART Domains Protein: ENSMUSP00000092751
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
ARM 114 154 1.67e-6 SMART
ARM 156 196 4.28e-4 SMART
ARM 198 238 5.43e-6 SMART
ARM 240 280 4.6e0 SMART
ARM 282 322 3.09e1 SMART
ARM 323 365 3.93e-3 SMART
Blast:ARM 367 409 7e-17 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173763
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173763
SMART Domains Protein: ENSMUSP00000133383
Gene: ENSMUSG00000037708

DomainStartEndE-ValueType
ARM 8 48 2.26e-3 SMART
Blast:ARM 50 90 2e-14 BLAST
ARM 92 132 1.67e-6 SMART
ARM 134 166 5.76e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Spag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spag6 APN 2 18734184 missense probably benign 0.31
IGL01352:Spag6 APN 2 18710473 missense possibly damaging 0.77
IGL02795:Spag6 APN 2 18733083 missense probably benign
IGL03406:Spag6 APN 2 18742873 splice site probably benign
R0362:Spag6 UTSW 2 18710491 missense probably damaging 0.99
R0423:Spag6 UTSW 2 18710593 missense probably benign 0.00
R1309:Spag6 UTSW 2 18734216 missense probably damaging 1.00
R1386:Spag6 UTSW 2 18734246 missense possibly damaging 0.49
R1568:Spag6 UTSW 2 18733114 missense probably benign
R1716:Spag6 UTSW 2 18745609 splice site probably null
R1771:Spag6 UTSW 2 18734117 missense probably benign 0.22
R1911:Spag6 UTSW 2 18715805 nonsense probably null
R1985:Spag6 UTSW 2 18732119 missense probably benign 0.00
R2029:Spag6 UTSW 2 18734105 unclassified probably benign
R2131:Spag6 UTSW 2 18733097 nonsense probably null
R3705:Spag6 UTSW 2 18710557 missense probably damaging 0.99
R4585:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4586:Spag6 UTSW 2 18732147 critical splice donor site probably null
R4692:Spag6 UTSW 2 18699243 missense probably benign 0.24
R4745:Spag6 UTSW 2 18737296 missense possibly damaging 0.78
R4890:Spag6 UTSW 2 18742777 missense probably benign 0.00
R4914:Spag6 UTSW 2 18745549 missense probably benign 0.00
R4918:Spag6 UTSW 2 18745549 missense probably benign 0.00
R5086:Spag6 UTSW 2 18742877 splice site probably benign
R5264:Spag6 UTSW 2 18745513 missense probably benign 0.00
R5729:Spag6 UTSW 2 18715714 missense probably benign
R5754:Spag6 UTSW 2 18698802 unclassified probably benign
R5781:Spag6 UTSW 2 18731993 missense probably benign
R5954:Spag6 UTSW 2 18710606 missense probably damaging 1.00
R6246:Spag6 UTSW 2 18699095 critical splice donor site probably null
R7607:Spag6 UTSW 2 18731962 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGAATTTGCAGAAAGTCCCATG -3'
(R):5'- ATATATGCAAGTGCCCAGGC -3'

Sequencing Primer
(F):5'- AGTTTGAAACTGACCTTGCTTCTAGG -3'
(R):5'- GCTGCAGCCTCCTTGAC -3'
Posted On2015-06-12