Incidental Mutation 'R4230:Tgm5'
ID320769
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121070735 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect probably damaging
Transcript: ENSMUST00000028721
AA Change: T292A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: T292A

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142674
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0117:Tgm5 UTSW 2 121075102 critical splice donor site probably null
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1674:Tgm5 UTSW 2 121071544 missense possibly damaging 0.60
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7178:Tgm5 UTSW 2 121085768 start gained probably benign
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
RF022:Tgm5 UTSW 2 121071611 missense probably damaging 1.00
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGAAATAAGTCCAAACGGGTG -3'
(R):5'- CACATCCTGTGGAGGGATTAGTTG -3'

Sequencing Primer
(F):5'- TAAGTCCAAACGGGTGAGCTC -3'
(R):5'- TGGCTTCTCCTTAGATAAACAGC -3'
Posted On2015-06-12