Mutagenetix > Incidental Mutation

Incidental Mutation 'R4230:Sec61a1'

320781

Institutional Source

Beutler Lab

Gene Symbol

Sec61a1

Ensembl Gene

ENSMUSG00000030082

Gene Name

SEC61 translocon subunit alpha 1

Synonyms

Sec61a

MMRRC Submission

041049-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R4230 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88480589-88495782 bp(-) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 88492413 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032168] [ENSMUST00000032168] [ENSMUST00000032168]

AlphaFold

P61620

Predicted Effect

probably null
Transcript: ENSMUST00000032168

SMART Domains

Protein: ENSMUSP00000032168
Gene: ENSMUSG00000030082

Domain	Start	End	E-Value	Type
Pfam:Plug_translocon	40	74	6.2e-21	PFAM
Pfam:SecY	75	458	3.1e-79	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000032168

SMART Domains

Protein: ENSMUSP00000032168
Gene: ENSMUSG00000030082

Domain	Start	End	E-Value	Type
Pfam:Plug_translocon	40	74	6.2e-21	PFAM
Pfam:SecY	75	458	3.1e-79	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000032168

SMART Domains

Protein: ENSMUSP00000032168
Gene: ENSMUSG00000030082

Domain	Start	End	E-Value	Type
Pfam:Plug_translocon	40	74	6.2e-21	PFAM
Pfam:SecY	75	458	3.1e-79	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125016

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139551

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145421

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155079

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203200

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SECY/SEC61- alpha family. It appears to play a crucial role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. This protein found to be tightly associated with membrane-bound ribosomes, either directly or through adaptor proteins. This gene encodes an alpha subunit of the heteromeric SEC61 complex, which also contains beta and gamma subunits. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased body weight, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, apoptosis of beta-cells, and enlarged and pale liver with hepatic steatosis and cirrhosis when fed a high fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Alg11	T	A	8: 22,555,534 (GRCm39)	I223N	probably damaging	Het
Ankrd26	G	C	6: 118,536,349 (GRCm39)		probably null	Het
Apbb1	T	C	7: 105,216,891 (GRCm39)	D264G	probably damaging	Het
Arhgap32	T	C	9: 32,168,770 (GRCm39)	Y918H	probably benign	Het
Astn2	T	G	4: 65,829,919 (GRCm39)	T584P	probably damaging	Het
Atxn7	G	A	14: 14,100,381 (GRCm38)	S689N	probably benign	Het
Cacna1h	T	C	17: 25,606,837 (GRCm39)	N873S	probably damaging	Het
Cadps	T	A	14: 12,488,987 (GRCm38)	I857F	probably damaging	Het
Cfap119	T	A	7: 127,186,002 (GRCm39)	M102L	probably benign	Het
Cog6	T	C	3: 52,900,229 (GRCm39)	T511A	probably benign	Het
Dppa3	A	T	6: 122,606,291 (GRCm39)	N118I	probably damaging	Het
Dst	A	G	1: 34,234,909 (GRCm39)	N3663D	probably benign	Het
Eif1ad14	A	T	12: 87,886,567 (GRCm39)	S21T	unknown	Het
Eme1	G	A	11: 94,538,818 (GRCm39)	T354M	possibly damaging	Het
Gm10735	T	C	13: 113,177,743 (GRCm39)		probably benign	Het
Ifi44l	A	T	3: 151,468,514 (GRCm39)	C5*	probably null	Het
Itln1	G	A	1: 171,362,375 (GRCm39)	T2I	probably benign	Het
Jam2	T	A	16: 84,618,180 (GRCm39)	M309K	possibly damaging	Het
Kcnk5	C	A	14: 20,194,852 (GRCm39)	C162F	probably damaging	Het
Metrn	A	G	17: 26,015,915 (GRCm39)		probably benign	Het
Muc5b	T	A	7: 141,417,259 (GRCm39)	Y3402N	probably benign	Het
Ncoa7	A	T	10: 30,574,253 (GRCm39)		probably null	Het
Nxpe4	A	G	9: 48,304,122 (GRCm39)	R70G	possibly damaging	Het
Onecut3	T	C	10: 80,349,793 (GRCm39)	I429T	probably damaging	Het
Or2n1	A	C	17: 38,486,772 (GRCm39)	I266L	possibly damaging	Het
Or2z9	T	C	8: 72,854,188 (GRCm39)	Y195H	probably damaging	Het
Or4k37	T	G	2: 111,159,475 (GRCm39)	L237R	probably damaging	Het
Or52e18	A	T	7: 104,609,801 (GRCm39)	I46N	probably benign	Het
Pds5a	A	G	5: 65,787,329 (GRCm39)	S858P	possibly damaging	Het
Phf11c	A	T	14: 59,630,516 (GRCm39)	V63E	probably benign	Het
Rasa3	A	G	8: 13,620,264 (GRCm39)	F802L	possibly damaging	Het
Sec24b	G	T	3: 129,834,368 (GRCm39)	Q141K	probably benign	Het
Slc45a3	T	A	1: 131,909,399 (GRCm39)	L532Q	probably damaging	Het
Slc46a2	T	C	4: 59,914,048 (GRCm39)	I292V	probably benign	Het
Smg1	C	T	7: 117,747,956 (GRCm39)		probably null	Het
Spag6	T	A	2: 18,720,449 (GRCm39)		probably null	Het
Spi1	T	C	2: 90,945,680 (GRCm39)	F254L	probably damaging	Het
Sspo	T	C	6: 48,467,868 (GRCm39)	S4272P	probably benign	Het
Tgm5	T	C	2: 120,901,216 (GRCm39)	T292A	probably damaging	Het
Tmem229a	T	A	6: 24,954,831 (GRCm39)	I308F	probably damaging	Het
Ttn	T	C	2: 76,554,464 (GRCm39)	I30784V	possibly damaging	Het
Urod	T	A	4: 116,849,880 (GRCm39)	T173S	probably benign	Het
Vmn1r223	A	T	13: 23,433,585 (GRCm39)	M60L	probably benign	Het
Vmn2r2	T	A	3: 64,041,912 (GRCm39)	I268L	probably benign	Het
Vwa8	C	T	14: 79,320,292 (GRCm39)	T1101M	probably benign	Het
Zc3h12c	T	A	9: 52,055,728 (GRCm39)		probably null	Het

Other mutations in Sec61a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Sec61a1	APN	6	88,483,922 (GRCm39)	splice site	probably benign
IGL01481:Sec61a1	APN	6	88,483,829 (GRCm39)	missense	probably benign
R3025:Sec61a1	UTSW	6	88,489,202 (GRCm39)	missense	probably damaging	0.96
R4598:Sec61a1	UTSW	6	88,483,131 (GRCm39)	missense	probably benign
R6232:Sec61a1	UTSW	6	88,482,150 (GRCm39)	missense	probably benign	0.29
R7363:Sec61a1	UTSW	6	88,492,533 (GRCm39)	missense	probably benign	0.00
R7510:Sec61a1	UTSW	6	88,489,585 (GRCm39)	missense	probably benign	0.04
R7851:Sec61a1	UTSW	6	88,489,147 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TATAAAGCCAAATCCTGTCAGGG -3'
(R):5'- AGCAGCCTCTGAGAAATGGG -3'

Sequencing Primer
(F):5'- GGGAAGTAACCAGGCTTTTCATCC -3'
(R):5'- CCTCTGAGAAATGGGGAATGTGATC -3'

Posted On

2015-06-12