Incidental Mutation 'R4230:Zc3h12c'
ID320797
Institutional Source Beutler Lab
Gene Symbol Zc3h12c
Ensembl Gene ENSMUSG00000035164
Gene Namezinc finger CCCH type containing 12C
SynonymsC230027N18Rik
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location52111344-52168572 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 52144428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165519] [ENSMUST00000213645]
Predicted Effect probably null
Transcript: ENSMUST00000165519
SMART Domains Protein: ENSMUSP00000127603
Gene: ENSMUSG00000035164

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
Pfam:RNase_Zc3h12a 264 420 1.6e-67 PFAM
low complexity region 644 659 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213645
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Other mutations in Zc3h12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zc3h12c APN 9 52116665 missense probably damaging 1.00
IGL01288:Zc3h12c APN 9 52117651 splice site probably benign
IGL01993:Zc3h12c APN 9 52116311 missense probably damaging 1.00
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0131:Zc3h12c UTSW 9 52126623 missense possibly damaging 0.87
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R1762:Zc3h12c UTSW 9 52115781 missense probably benign 0.17
R2101:Zc3h12c UTSW 9 52116421 missense probably benign 0.01
R3052:Zc3h12c UTSW 9 52144056 missense possibly damaging 0.94
R3689:Zc3h12c UTSW 9 52115956 missense probably benign 0.00
R4163:Zc3h12c UTSW 9 52115699 missense probably damaging 1.00
R4803:Zc3h12c UTSW 9 52116553 missense probably damaging 1.00
R5008:Zc3h12c UTSW 9 52116700 missense probably benign 0.00
R5153:Zc3h12c UTSW 9 52126647 missense probably damaging 1.00
R5682:Zc3h12c UTSW 9 52126576 missense probably damaging 1.00
R5843:Zc3h12c UTSW 9 52116682 missense probably benign 0.01
R6613:Zc3h12c UTSW 9 52116112 missense possibly damaging 0.65
R7097:Zc3h12c UTSW 9 52115926 missense possibly damaging 0.77
R7460:Zc3h12c UTSW 9 52144102 missense probably benign 0.13
R7867:Zc3h12c UTSW 9 52143948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCCGAATTGACTGTATCCATTG -3'
(R):5'- AACCCAGTTTGGCTTTCTGG -3'

Sequencing Primer
(F):5'- AATTGACTGTATCCATTGTTGGTTTC -3'
(R):5'- CCCAGTTTGGCTTTCTGGTTACTTTG -3'
Posted On2015-06-12