Incidental Mutation 'R0396:Tbc1d4'
ID 32080
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene Name TBC1 domain family, member 4
Synonyms AS160, 5930406J04Rik
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 101679796-101846627 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 101695499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000162617] [ENSMUST00000162617] [ENSMUST00000161991] [ENSMUST00000161991]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100340
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect probably benign
Transcript: ENSMUST00000159664
SMART Domains Protein: ENSMUSP00000124734
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
SCOP:d1ddma_ 2 48 1e-6 SMART
Blast:PTB 2 58 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect probably null
Transcript: ENSMUST00000159951
SMART Domains Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 28 170 8.6e-22 SMART
Pfam:DUF3350 459 522 2.3e-31 PFAM
TBC 574 794 5.2e-77 SMART
Blast:TBC 819 877 7e-24 BLAST
Blast:TBC 882 936 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159951
SMART Domains Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 28 170 8.6e-22 SMART
Pfam:DUF3350 459 522 2.3e-31 PFAM
TBC 574 794 5.2e-77 SMART
Blast:TBC 819 877 7e-24 BLAST
Blast:TBC 882 936 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect probably null
Transcript: ENSMUST00000162617
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000162617
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000161991
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000161991
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161304
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
D630045J12Rik T C 6: 38,173,671 (GRCm39) S166G possibly damaging Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Myom1 T A 17: 71,341,688 (GRCm39) V149E probably damaging Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Nedd4l T A 18: 65,294,725 (GRCm39) probably benign Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sdk2 T C 11: 113,720,793 (GRCm39) I1379V probably benign Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Vmn2r28 T A 7: 5,491,513 (GRCm39) I245L probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101,845,548 (GRCm39) missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101,682,002 (GRCm39) missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101,686,629 (GRCm39) splice site probably benign
IGL01144:Tbc1d4 APN 14 101,682,099 (GRCm39) missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101,845,451 (GRCm39) missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101,727,300 (GRCm39) nonsense probably null
IGL02177:Tbc1d4 APN 14 101,692,375 (GRCm39) missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101,703,166 (GRCm39) missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101,738,536 (GRCm39) missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101,695,549 (GRCm39) missense probably damaging 1.00
R0787:Tbc1d4 UTSW 14 101,686,645 (GRCm39) missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101,716,656 (GRCm39) splice site probably benign
R1167:Tbc1d4 UTSW 14 101,845,455 (GRCm39) missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101,744,542 (GRCm39) missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101,685,124 (GRCm39) missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101,685,124 (GRCm39) missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101,712,651 (GRCm39) missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101,744,574 (GRCm39) missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101,714,591 (GRCm39) missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101,731,847 (GRCm39) missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101,731,797 (GRCm39) missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101,696,191 (GRCm39) missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101,744,649 (GRCm39) missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101,845,772 (GRCm39) missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101,696,219 (GRCm39) missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101,700,263 (GRCm39) intron probably benign
R4872:Tbc1d4 UTSW 14 101,682,144 (GRCm39) missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101,744,667 (GRCm39) missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101,695,610 (GRCm39) missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101,695,610 (GRCm39) missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101,696,318 (GRCm39) nonsense probably null
R5180:Tbc1d4 UTSW 14 101,745,008 (GRCm39) missense probably damaging 1.00
R5366:Tbc1d4 UTSW 14 101,845,412 (GRCm39) missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101,692,444 (GRCm39) missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101,727,353 (GRCm39) missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101,696,206 (GRCm39) missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101,744,610 (GRCm39) missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101,845,754 (GRCm39) missense possibly damaging 0.92
R6791:Tbc1d4 UTSW 14 101,845,695 (GRCm39) missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101,696,185 (GRCm39) missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101,724,877 (GRCm39) missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101,685,025 (GRCm39) missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101,745,077 (GRCm39) missense probably damaging 1.00
R7936:Tbc1d4 UTSW 14 101,703,190 (GRCm39) missense probably damaging 1.00
R7991:Tbc1d4 UTSW 14 101,845,715 (GRCm39) missense probably damaging 0.98
R8182:Tbc1d4 UTSW 14 101,744,990 (GRCm39) missense probably damaging 1.00
R8540:Tbc1d4 UTSW 14 101,845,712 (GRCm39) missense probably damaging 1.00
R9126:Tbc1d4 UTSW 14 101,724,952 (GRCm39) missense probably benign 0.01
R9282:Tbc1d4 UTSW 14 101,845,616 (GRCm39) missense possibly damaging 0.93
R9288:Tbc1d4 UTSW 14 101,692,308 (GRCm39) missense probably damaging 1.00
R9385:Tbc1d4 UTSW 14 101,700,356 (GRCm39) missense probably damaging 1.00
R9424:Tbc1d4 UTSW 14 101,703,096 (GRCm39) missense probably damaging 1.00
R9494:Tbc1d4 UTSW 14 101,845,895 (GRCm39) start codon destroyed probably null 0.90
R9655:Tbc1d4 UTSW 14 101,744,567 (GRCm39) missense probably damaging 1.00
R9658:Tbc1d4 UTSW 14 101,845,856 (GRCm39) missense probably damaging 0.98
R9712:Tbc1d4 UTSW 14 101,744,846 (GRCm39) missense probably benign
Z1088:Tbc1d4 UTSW 14 101,689,859 (GRCm39) missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101,744,523 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGATCATGACAGAGTGGCACTTG -3'
(R):5'- GCTCATCTACTGAGATGTCAACGGC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGATGTCAACGGCTTTATTCC -3'
Posted On 2013-04-24