Mutagenetix > Incidental Mutation

Incidental Mutation 'R0396:Tbc1d4'

32080

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d4

Ensembl Gene

ENSMUSG00000033083

Gene Name

TBC1 domain family, member 4

Synonyms

5930406J04Rik, AS160

MMRRC Submission

038602-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101442360-101609191 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 101458063 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000161991] [ENSMUST00000162617] [ENSMUST00000162617]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000100340

SMART Domains

Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
low complexity region	708	720	N/A	INTRINSIC
Blast:TBC	773	834	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159484

Predicted Effect

probably benign
Transcript: ENSMUST00000159664

SMART Domains

Protein: ENSMUSP00000124734
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
SCOP:d1ddma_	2	48	1e-6	SMART
Blast:PTB	2	58	3e-35	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159668

Predicted Effect

probably null
Transcript: ENSMUST00000159951

SMART Domains

Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	28	170	8.6e-22	SMART
Pfam:DUF3350	459	522	2.3e-31	PFAM
TBC	574	794	5.2e-77	SMART
Blast:TBC	819	877	7e-24	BLAST
Blast:TBC	882	936	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000159951

SMART Domains

Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	28	170	8.6e-22	SMART
Pfam:DUF3350	459	522	2.3e-31	PFAM
TBC	574	794	5.2e-77	SMART
Blast:TBC	819	877	7e-24	BLAST
Blast:TBC	882	936	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160297

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161304

Predicted Effect

probably null
Transcript: ENSMUST00000161991

SMART Domains

Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
Pfam:DUF3350	746	809	1.2e-27	PFAM
TBC	860	1080	5.2e-77	SMART
Blast:TBC	1105	1163	1e-23	BLAST
Blast:TBC	1168	1222	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000161991

SMART Domains

Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
Pfam:DUF3350	746	809	1.2e-27	PFAM
TBC	860	1080	5.2e-77	SMART
Blast:TBC	1105	1163	1e-23	BLAST
Blast:TBC	1168	1222	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000162617

SMART Domains

Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
low complexity region	708	720	N/A	INTRINSIC
Pfam:DUF3350	809	872	3.3e-31	PFAM
TBC	923	1143	5.2e-77	SMART
Blast:TBC	1168	1226	2e-23	BLAST
Blast:TBC	1231	1285	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000162617

SMART Domains

Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083

Domain	Start	End	E-Value	Type
PTB	31	191	2.08e-29	SMART
PTB	197	457	3.16e-29	SMART
low complexity region	708	720	N/A	INTRINSIC
Pfam:DUF3350	809	872	3.3e-31	PFAM
TBC	923	1143	5.2e-77	SMART
Blast:TBC	1168	1226	2e-23	BLAST
Blast:TBC	1231	1285	1e-20	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Kdr	T	C	5: 75,960,728	I541V	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Kif16b	C	T	2: 142,853,659	R175H	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Sf3b1	C	T	1: 55,019,271	G53E	probably damaging	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sptan1	T	C	2: 29,991,033	V438A	probably damaging	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Trrap	C	A	5: 144,814,556	Q1640K	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Tbc1d4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tbc1d4	APN	14	101608112	missense	probably damaging	1.00
IGL00864:Tbc1d4	APN	14	101444566	missense	probably benign	0.23
IGL01065:Tbc1d4	APN	14	101449193	splice site	probably benign
IGL01144:Tbc1d4	APN	14	101444663	missense	probably damaging	0.99
IGL01153:Tbc1d4	APN	14	101608015	missense	possibly damaging	0.52
IGL01472:Tbc1d4	APN	14	101489864	nonsense	probably null
IGL02177:Tbc1d4	APN	14	101454939	missense	possibly damaging	0.90
IGL02259:Tbc1d4	APN	14	101465730	missense	probably damaging	1.00
IGL02938:Tbc1d4	APN	14	101501100	missense	probably damaging	1.00
IGL02975:Tbc1d4	APN	14	101458113	missense	probably damaging	1.00
R0787:Tbc1d4	UTSW	14	101449209	missense	probably damaging	1.00
R0944:Tbc1d4	UTSW	14	101479220	splice site	probably benign
R1167:Tbc1d4	UTSW	14	101608019	missense	probably damaging	1.00
R1456:Tbc1d4	UTSW	14	101507106	missense	probably damaging	1.00
R1465:Tbc1d4	UTSW	14	101447688	missense	possibly damaging	0.87
R1465:Tbc1d4	UTSW	14	101447688	missense	possibly damaging	0.87
R1672:Tbc1d4	UTSW	14	101475215	missense	possibly damaging	0.92
R1762:Tbc1d4	UTSW	14	101507138	missense	possibly damaging	0.95
R2057:Tbc1d4	UTSW	14	101477155	missense	probably damaging	0.97
R2260:Tbc1d4	UTSW	14	101494411	missense	probably damaging	1.00
R2762:Tbc1d4	UTSW	14	101494361	missense	probably damaging	1.00
R3814:Tbc1d4	UTSW	14	101458755	missense	possibly damaging	0.94
R3983:Tbc1d4	UTSW	14	101507213	missense	probably benign	0.00
R4498:Tbc1d4	UTSW	14	101608336	missense	probably damaging	1.00
R4580:Tbc1d4	UTSW	14	101458783	missense	probably benign	0.00
R4664:Tbc1d4	UTSW	14	101462827	intron	probably benign
R4872:Tbc1d4	UTSW	14	101444708	missense	probably benign	0.06
R4940:Tbc1d4	UTSW	14	101507231	missense	probably benign	0.27
R4964:Tbc1d4	UTSW	14	101458174	missense	probably damaging	1.00
R4966:Tbc1d4	UTSW	14	101458174	missense	probably damaging	1.00
R5103:Tbc1d4	UTSW	14	101458882	nonsense	probably null
R5180:Tbc1d4	UTSW	14	101507572	missense	probably damaging	1.00
R5366:Tbc1d4	UTSW	14	101607976	missense	possibly damaging	0.67
R5673:Tbc1d4	UTSW	14	101455008	missense	probably damaging	1.00
R6057:Tbc1d4	UTSW	14	101489917	missense	probably damaging	0.99
R6180:Tbc1d4	UTSW	14	101458770	missense	probably benign	0.01
R6361:Tbc1d4	UTSW	14	101507174	missense	probably damaging	0.97
R6509:Tbc1d4	UTSW	14	101608318	missense	possibly damaging	0.92
R6791:Tbc1d4	UTSW	14	101608259	missense	probably damaging	0.98
R7001:Tbc1d4	UTSW	14	101458749	missense	probably benign	0.43
R7016:Tbc1d4	UTSW	14	101487441	missense	probably damaging	1.00
R7575:Tbc1d4	UTSW	14	101447589	missense	probably damaging	1.00
R7691:Tbc1d4	UTSW	14	101507641	missense	probably damaging	1.00
R7936:Tbc1d4	UTSW	14	101465754	missense	probably damaging	1.00
R7991:Tbc1d4	UTSW	14	101608279	missense	probably damaging	0.98
R8182:Tbc1d4	UTSW	14	101507554	missense	probably damaging	1.00
R8540:Tbc1d4	UTSW	14	101608276	missense	probably damaging	1.00
R9126:Tbc1d4	UTSW	14	101487516	missense	probably benign	0.01
R9282:Tbc1d4	UTSW	14	101608180	missense	possibly damaging	0.93
R9288:Tbc1d4	UTSW	14	101454872	missense	probably damaging	1.00
R9385:Tbc1d4	UTSW	14	101462920	missense	probably damaging	1.00
R9424:Tbc1d4	UTSW	14	101465660	missense	probably damaging	1.00
R9494:Tbc1d4	UTSW	14	101608459	start codon destroyed	probably null	0.90
R9655:Tbc1d4	UTSW	14	101507131	missense	probably damaging	1.00
R9658:Tbc1d4	UTSW	14	101608420	missense	probably damaging	0.98
R9712:Tbc1d4	UTSW	14	101507410	missense	probably benign
Z1088:Tbc1d4	UTSW	14	101452423	missense	probably damaging	1.00
Z1176:Tbc1d4	UTSW	14	101507087	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGATCATGACAGAGTGGCACTTG -3'
(R):5'- GCTCATCTACTGAGATGTCAACGGC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGATGTCAACGGCTTTATTCC -3'

Posted On

2013-04-24