Incidental Mutation 'R4230:Eme1'
ID320801
Institutional Source Beutler Lab
Gene Symbol Eme1
Ensembl Gene ENSMUSG00000039055
Gene Nameessential meiotic structure-specific endonuclease 1
Synonyms
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94644996-94653964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94647992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 354 (T354M)
Ref Sequence ENSEMBL: ENSMUSP00000036361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021239] [ENSMUST00000039949]
Predicted Effect probably benign
Transcript: ENSMUST00000021239
SMART Domains Protein: ENSMUSP00000021239
Gene: ENSMUSG00000020869

DomainStartEndE-ValueType
LRR 38 60 6.22e0 SMART
LRR 61 83 1.33e-1 SMART
LRR 84 106 3.75e0 SMART
LRR 107 131 1.09e2 SMART
coiled coil region 148 216 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000039949
AA Change: T354M

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036361
Gene: ENSMUSG00000039055
AA Change: T354M

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
ERCC4 252 515 2.06e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128643
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that complexes with methyl methanesulfonate-sensitive UV-sensitive 81 protein to form an endonuclease complex. The encoded protein interacts with specifc DNA structures including nicked Holliday junctions, 3'-flap structures and aberrant replication fork structures. This protein may be involved in repairing DNA damage and in maintaining genomic stability. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Cog6 T C 3: 52,992,808 T511A probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Eme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Eme1 APN 11 94645451 missense probably damaging 1.00
IGL02402:Eme1 APN 11 94650907 missense possibly damaging 0.65
R0220:Eme1 UTSW 11 94650258 missense probably null 1.00
R0594:Eme1 UTSW 11 94650430 missense possibly damaging 0.63
R0608:Eme1 UTSW 11 94650082 missense probably damaging 1.00
R0842:Eme1 UTSW 11 94650874 missense probably benign 0.24
R0925:Eme1 UTSW 11 94650732 missense probably damaging 0.99
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1146:Eme1 UTSW 11 94645451 missense probably damaging 1.00
R1161:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1310:Eme1 UTSW 11 94645542 missense probably damaging 1.00
R1837:Eme1 UTSW 11 94645961 missense probably benign 0.14
R2138:Eme1 UTSW 11 94648192 missense probably damaging 1.00
R2420:Eme1 UTSW 11 94645814 critical splice donor site probably null
R2427:Eme1 UTSW 11 94650975 unclassified probably benign
R3807:Eme1 UTSW 11 94650592 missense probably damaging 1.00
R6889:Eme1 UTSW 11 94650477 missense probably benign 0.00
R7752:Eme1 UTSW 11 94650819 missense probably damaging 1.00
R7759:Eme1 UTSW 11 94645840 nonsense probably null
R7901:Eme1 UTSW 11 94650819 missense probably damaging 1.00
X0021:Eme1 UTSW 11 94650518 missense possibly damaging 0.56
Z1176:Eme1 UTSW 11 94650696 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGTTGCAGGACAATTGACCAG -3'
(R):5'- CAATCCTGGTGTTGGTCCTG -3'

Sequencing Primer
(F):5'- GCACATCCCACAGCTGGTC -3'
(R):5'- CAGAGGTCTTCATGTCCATGGC -3'
Posted On2015-06-12