Mutagenetix > Incidental Mutation

Incidental Mutation 'R4231:Plxna2'

320820

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

041050-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 194644454 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 232 (T232I)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027952
AA Change: T232I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: T232I

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Meta Mutation Damage Score

0.2540

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GAAGGAACACTACTTGTCCAGTG -3'
(R):5'- ACTTGGGGTCATCCTTGCAG -3'

Sequencing Primer
(F):5'- TCAATAAGACAGGCACCATGTATG -3'
(R):5'- CTTGCAGAGACGCACAATTCTTGAG -3'

Posted On

2015-06-12