Mutagenetix > Incidental Mutations

Incidental Mutation 'R4231:Tgm3'

320825

Institutional Source

Beutler Lab

Gene Symbol

Tgm3

Ensembl Gene

ENSMUSG00000027401

Gene Name

transglutaminase 3, E polypeptide

Synonyms

TG E

MMRRC Submission

041050-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130012349-130050399 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 130044589 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 577 (K577*)

Ref Sequence

ENSEMBL: ENSMUSP00000105928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110299]

Predicted Effect

probably null
Transcript: ENSMUST00000110299
AA Change: K577*

SMART Domains

Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: K577*

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Tgm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Tgm3	APN	2	130038413	missense	probably damaging	1.00
IGL00924:Tgm3	APN	2	130038374	missense	probably damaging	1.00
IGL01469:Tgm3	APN	2	130024494	missense	probably damaging	1.00
IGL01722:Tgm3	APN	2	130044568	missense	probably damaging	0.99
IGL01787:Tgm3	APN	2	130047740	missense	possibly damaging	0.85
IGL02269:Tgm3	APN	2	130024518	missense	probably benign	0.02
IGL02437:Tgm3	APN	2	130030041	splice site	probably null
IGL02449:Tgm3	APN	2	130038609	critical splice donor site	probably null
IGL02992:Tgm3	APN	2	130041979	missense	probably damaging	1.00
tortellini	UTSW	2	130024585	critical splice donor site	probably benign
ANU74:Tgm3	UTSW	2	130048390	missense	probably damaging	1.00
R0523:Tgm3	UTSW	2	130044662	critical splice donor site	probably null
R0833:Tgm3	UTSW	2	130026682	splice site	probably benign
R0834:Tgm3	UTSW	2	130026757	missense	probably benign	0.00
R0836:Tgm3	UTSW	2	130026682	splice site	probably benign
R0940:Tgm3	UTSW	2	130012406	missense	probably benign	0.00
R1354:Tgm3	UTSW	2	130041898	missense	probably benign
R1642:Tgm3	UTSW	2	130047782	missense	probably damaging	1.00
R1670:Tgm3	UTSW	2	130041768	nonsense	probably null
R1715:Tgm3	UTSW	2	130026814	critical splice donor site	probably null
R1944:Tgm3	UTSW	2	130029969	missense	probably damaging	0.99
R2104:Tgm3	UTSW	2	130037483	missense	probably benign	0.39
R3416:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R3417:Tgm3	UTSW	2	130047772	missense	possibly damaging	0.84
R4296:Tgm3	UTSW	2	130038413	missense	possibly damaging	0.77
R4794:Tgm3	UTSW	2	130041955	missense	probably benign	0.00
R4948:Tgm3	UTSW	2	130048320	missense	probably benign	0.00
R5034:Tgm3	UTSW	2	130037484	missense	possibly damaging	0.95
R5144:Tgm3	UTSW	2	130048282	missense	possibly damaging	0.95
R5786:Tgm3	UTSW	2	130026784	nonsense	probably null
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6030:Tgm3	UTSW	2	130042000	missense	probably damaging	1.00
R6182:Tgm3	UTSW	2	130025301	nonsense	probably null
R6219:Tgm3	UTSW	2	130038610	critical splice donor site	probably null
R6901:Tgm3	UTSW	2	130041970	missense	possibly damaging	0.95
R6969:Tgm3	UTSW	2	130042029	missense	probably benign	0.06
R6980:Tgm3	UTSW	2	130026777	missense	probably benign	0.17
R7282:Tgm3	UTSW	2	130024561	missense	probably benign	0.00
R7317:Tgm3	UTSW	2	130048291	missense	probably benign	0.09
R7513:Tgm3	UTSW	2	130024404	missense	probably benign	0.00
R7517:Tgm3	UTSW	2	130041764	missense	probably benign	0.01
R7793:Tgm3	UTSW	2	130012410	critical splice donor site	probably null
R7822:Tgm3	UTSW	2	130041899	missense	probably benign	0.00
R7955:Tgm3	UTSW	2	130038480	missense	probably benign
X0065:Tgm3	UTSW	2	130024510	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCAACATACAGAGCCTCCTG -3'
(R):5'- TCCAAAAGGCTCTTATGTACATCC -3'

Sequencing Primer
(F):5'- TACAGAGCCTCCTGCCAGC -3'
(R):5'- GGTCAAAGCAGGATTATCC -3'

Posted On

2015-06-12