Mutagenetix > Incidental Mutation

Incidental Mutation 'R4231:Rin2'

320826

Institutional Source

Beutler Lab

Gene Symbol

Rin2

Ensembl Gene

ENSMUSG00000001768

Gene Name

Ras and Rab interactor 2

Synonyms

RASSF4, 4632403N06Rik, 2010003K16Rik

MMRRC Submission

041050-MU

Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145675215-145887616 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 145860446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 354 (T354I)

Ref Sequence

ENSEMBL: ENSMUSP00000105632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]

AlphaFold

Q9D684

Predicted Effect

probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

Domain	Start	End	E-Value	Type
SH2	50	136	1.38e-3	SMART
low complexity region	175	187	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	375	385	N/A	INTRINSIC
low complexity region	393	411	N/A	INTRINSIC
Blast:SH2	540	576	2e-7	BLAST
VPS9	612	730	1.72e-68	SMART
RA	751	842	3.35e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

Domain	Start	End	E-Value	Type
SH2	95	181	1.38e-3	SMART
low complexity region	220	232	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	380	397	N/A	INTRINSIC
low complexity region	420	430	N/A	INTRINSIC
low complexity region	438	456	N/A	INTRINSIC
Blast:SH2	585	621	2e-7	BLAST
VPS9	657	775	1.72e-68	SMART
RA	796	887	3.35e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145874

Predicted Effect

probably benign
Transcript: ENSMUST00000147976

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Rin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02928:Rin2	APN	2	145860006	splice site	probably benign
IGL03222:Rin2	APN	2	145860195	nonsense	probably null
IGL03371:Rin2	APN	2	145885926	utr 3 prime	probably benign
IGL03411:Rin2	APN	2	145860944	missense	probably damaging	0.99
D4043:Rin2	UTSW	2	145822363	missense	possibly damaging	0.61
R0025:Rin2	UTSW	2	145878832	splice site	probably benign
R0110:Rin2	UTSW	2	145861033	missense	probably benign
R0144:Rin2	UTSW	2	145876639	missense	probably damaging	0.96
R0510:Rin2	UTSW	2	145861033	missense	probably benign
R1326:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1327:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1328:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1329:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1330:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R1544:Rin2	UTSW	2	145858446	missense	probably damaging	1.00
R1658:Rin2	UTSW	2	145876456	missense	probably benign	0.04
R1832:Rin2	UTSW	2	145861171	missense	possibly damaging	0.48
R1986:Rin2	UTSW	2	145878940	missense	probably damaging	1.00
R2137:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2167:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2170:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2260:Rin2	UTSW	2	145878904	missense	probably damaging	0.97
R2312:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R2884:Rin2	UTSW	2	145860991	missense	probably benign	0.07
R3155:Rin2	UTSW	2	145860851	missense	probably benign	0.17
R3771:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3772:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3773:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3822:Rin2	UTSW	2	145822630	missense	probably benign	0.02
R3824:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3825:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3885:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3893:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3939:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R3940:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4012:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4019:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4058:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4214:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4232:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4236:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4372:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4410:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4415:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4471:Rin2	UTSW	2	145860446	missense	probably benign	0.00
R4490:Rin2	UTSW	2	145822274	missense	possibly damaging	0.66
R4597:Rin2	UTSW	2	145860905	missense	probably benign	0.01
R5099:Rin2	UTSW	2	145878901	missense	probably damaging	1.00
R5268:Rin2	UTSW	2	145844760	missense	probably benign
R5493:Rin2	UTSW	2	145860709	missense	probably damaging	1.00
R5622:Rin2	UTSW	2	145860379	missense	probably benign	0.07
R5947:Rin2	UTSW	2	145844943	intron	probably benign
R6280:Rin2	UTSW	2	145861019	missense	probably damaging	1.00
R7009:Rin2	UTSW	2	145883475	missense	probably damaging	1.00
R7531:Rin2	UTSW	2	145858499	missense	probably benign
R7824:Rin2	UTSW	2	145861117	missense	probably benign	0.00
R8065:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8067:Rin2	UTSW	2	145861057	missense	probably damaging	0.99
R8144:Rin2	UTSW	2	145822305	missense	probably benign
R8510:Rin2	UTSW	2	145885691	missense	probably damaging	1.00
R8853:Rin2	UTSW	2	145876555	missense	possibly damaging	0.68
R8880:Rin2	UTSW	2	145848852	missense	probably damaging	1.00
R9224:Rin2	UTSW	2	145878902	nonsense	probably null
R9325:Rin2	UTSW	2	145885899	missense	probably benign	0.15
R9417:Rin2	UTSW	2	145844793	missense	probably benign	0.02
R9555:Rin2	UTSW	2	145876495	nonsense	probably null
R9631:Rin2	UTSW	2	145876517	missense	probably damaging	1.00
R9667:Rin2	UTSW	2	145860282	missense	possibly damaging	0.89
R9691:Rin2	UTSW	2	145848844	missense	probably damaging	0.97
R9727:Rin2	UTSW	2	145860586	missense	possibly damaging	0.94
R9780:Rin2	UTSW	2	145876631	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAAGTGCACAGCCAGGAC -3'
(R):5'- GAAAGGCTCATGTCGCTCAG -3'

Sequencing Primer
(F):5'- AGGACTCCCAACGCGAATGG -3'
(R):5'- TGTGATTCAGAGCCGGGC -3'

Posted On

2015-06-12