Mutagenetix > Incidental Mutations

Incidental Mutation 'R4231:Cd93'

320827

Institutional Source

Beutler Lab

Gene Symbol

Cd93

Ensembl Gene

ENSMUSG00000027435

Gene Name

CD93 antigen

Synonyms

C1qrp, AA4.1, Ly68, 6030404G09Rik, C1qr1

MMRRC Submission

041050-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148436640-148443563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 148442960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 155 (H155Q)

Ref Sequence

ENSEMBL: ENSMUSP00000096876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099269]

AlphaFold

O89103

Predicted Effect

probably benign
Transcript: ENSMUST00000099269
AA Change: H155Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000096876
Gene: ENSMUSG00000027435
AA Change: H155Q

Domain	Start	End	E-Value	Type
CLECT	23	180	5.04e-7	SMART
EGF	260	298	2.56e-3	SMART
EGF	302	341	3.73e-5	SMART
EGF_CA	342	381	1.33e-10	SMART
EGF_CA	382	423	4.38e-11	SMART
EGF_CA	424	465	1.33e-10	SMART
low complexity region	488	501	N/A	INTRINSIC
transmembrane domain	576	598	N/A	INTRINSIC
low complexity region	604	612	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have a defect in clearance of apoptotic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Cd93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0076:Cd93	UTSW	2	148442136	missense	probably benign
R0379:Cd93	UTSW	2	148441510	splice site	probably benign
R1951:Cd93	UTSW	2	148441858	missense	probably benign	0.01
R2399:Cd93	UTSW	2	148442151	missense	probably benign	0.37
R4830:Cd93	UTSW	2	148443379	nonsense	probably null
R5940:Cd93	UTSW	2	148442232	missense	probably benign	0.25
R6057:Cd93	UTSW	2	148441519	missense	probably damaging	1.00
R6797:Cd93	UTSW	2	148442124	missense	probably benign	0.00
R7142:Cd93	UTSW	2	148441805	nonsense	probably null
R7184:Cd93	UTSW	2	148442539	missense	possibly damaging	0.76
R7276:Cd93	UTSW	2	148441740	missense	probably damaging	0.98
R7315:Cd93	UTSW	2	148442541	missense	probably damaging	1.00
R8750:Cd93	UTSW	2	148443160	missense	probably benign	0.00
R8897:Cd93	UTSW	2	148441612	missense	probably benign	0.34
R9069:Cd93	UTSW	2	148442151	missense	probably benign	0.37
Z1088:Cd93	UTSW	2	148442364	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CCACAAGCTACATTGGCTACAG -3'
(R):5'- GCAAATTCTGGATCGGGCTC -3'

Sequencing Primer
(F):5'- GCCTACACATGCCTTTGAA -3'
(R):5'- CTCCAGCGAGAGAAGGGC -3'

Posted On

2015-06-12