Incidental Mutation 'R4231:Cd93'
ID 320827
Institutional Source Beutler Lab
Gene Symbol Cd93
Ensembl Gene ENSMUSG00000027435
Gene Name CD93 antigen
Synonyms C1qrp, AA4.1, Ly68, 6030404G09Rik, C1qr1
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4231 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 148436640-148443563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148442960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 155 (H155Q)
Ref Sequence ENSEMBL: ENSMUSP00000096876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099269]
AlphaFold O89103
Predicted Effect probably benign
Transcript: ENSMUST00000099269
AA Change: H155Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096876
Gene: ENSMUSG00000027435
AA Change: H155Q

DomainStartEndE-ValueType
CLECT 23 180 5.04e-7 SMART
EGF 260 298 2.56e-3 SMART
EGF 302 341 3.73e-5 SMART
EGF_CA 342 381 1.33e-10 SMART
EGF_CA 382 423 4.38e-11 SMART
EGF_CA 424 465 1.33e-10 SMART
low complexity region 488 501 N/A INTRINSIC
transmembrane domain 576 598 N/A INTRINSIC
low complexity region 604 612 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have a defect in clearance of apoptotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Cd93
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Cd93 UTSW 2 148442136 missense probably benign
R0379:Cd93 UTSW 2 148441510 splice site probably benign
R1951:Cd93 UTSW 2 148441858 missense probably benign 0.01
R2399:Cd93 UTSW 2 148442151 missense probably benign 0.37
R4830:Cd93 UTSW 2 148443379 nonsense probably null
R5940:Cd93 UTSW 2 148442232 missense probably benign 0.25
R6057:Cd93 UTSW 2 148441519 missense probably damaging 1.00
R6797:Cd93 UTSW 2 148442124 missense probably benign 0.00
R7142:Cd93 UTSW 2 148441805 nonsense probably null
R7184:Cd93 UTSW 2 148442539 missense possibly damaging 0.76
R7276:Cd93 UTSW 2 148441740 missense probably damaging 0.98
R7315:Cd93 UTSW 2 148442541 missense probably damaging 1.00
R8750:Cd93 UTSW 2 148443160 missense probably benign 0.00
R8897:Cd93 UTSW 2 148441612 missense probably benign 0.34
R9069:Cd93 UTSW 2 148442151 missense probably benign 0.37
Z1088:Cd93 UTSW 2 148442364 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCACAAGCTACATTGGCTACAG -3'
(R):5'- GCAAATTCTGGATCGGGCTC -3'

Sequencing Primer
(F):5'- GCCTACACATGCCTTTGAA -3'
(R):5'- CTCCAGCGAGAGAAGGGC -3'
Posted On 2015-06-12