Mutagenetix > Incidental Mutation

Incidental Mutation 'R4231:Med12l'

320831

Institutional Source

Beutler Lab

Gene Symbol

Med12l

Ensembl Gene

ENSMUSG00000056476

Gene Name

mediator complex subunit 12-like

Synonyms

MMRRC Submission

041050-MU

Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59005825-59318682 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 59257223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199659]

AlphaFold

Q8BQM9

Predicted Effect

probably null
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000050360

SMART Domains

Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

Domain	Start	End	E-Value	Type
Pfam:7tm_1	48	304	1.3e-40	PFAM
low complexity region	322	335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197374

Predicted Effect

probably benign
Transcript: ENSMUST00000199609

SMART Domains

Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

Domain	Start	End	E-Value	Type
Pfam:7tm_1	23	304	1.5e-31	PFAM
low complexity region	322	335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Med12l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Med12l	APN	3	59042336	missense	probably damaging	0.98
IGL00561:Med12l	APN	3	59227824	missense	probably benign
IGL00974:Med12l	APN	3	59083014	missense	probably damaging	1.00
IGL01024:Med12l	APN	3	59073341	missense	probably damaging	1.00
IGL01094:Med12l	APN	3	59093655	missense	probably damaging	0.99
IGL01134:Med12l	APN	3	59042275	missense	possibly damaging	0.91
IGL01535:Med12l	APN	3	59262259	missense	probably damaging	1.00
IGL01653:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL01735:Med12l	APN	3	59263254	missense	probably damaging	1.00
IGL01972:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL02005:Med12l	APN	3	59244947	missense	probably damaging	1.00
IGL02098:Med12l	APN	3	59275855	missense	possibly damaging	0.92
IGL02115:Med12l	APN	3	59068319	missense	probably benign	0.00
IGL02231:Med12l	APN	3	59245882	missense	probably damaging	1.00
IGL02259:Med12l	APN	3	59245843	missense	probably damaging	1.00
IGL02369:Med12l	APN	3	59257373	missense	probably benign	0.00
IGL02424:Med12l	APN	3	59092722	missense	probably benign	0.21
IGL02501:Med12l	APN	3	59261976	missense	possibly damaging	0.71
IGL02525:Med12l	APN	3	59068368	missense	probably benign	0.01
IGL02530:Med12l	APN	3	59077089	missense	probably damaging	1.00
IGL02735:Med12l	APN	3	59093646	missense	probably damaging	1.00
IGL02865:Med12l	APN	3	59294292	missense	probably damaging	1.00
IGL03183:Med12l	APN	3	59037555	splice site	probably null
IGL03264:Med12l	APN	3	59301367	nonsense	probably null
FR4304:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4340:Med12l	UTSW	3	59275985	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275988	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275994	small insertion	probably benign
FR4449:Med12l	UTSW	3	59275963	nonsense	probably null
FR4548:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4589:Med12l	UTSW	3	59275956	small insertion	probably benign
FR4976:Med12l	UTSW	3	59275977	small insertion	probably benign
P0007:Med12l	UTSW	3	59091395	splice site	probably benign
P0045:Med12l	UTSW	3	59091535	missense	probably damaging	0.99
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0148:Med12l	UTSW	3	59037654	missense	probably damaging	1.00
R0325:Med12l	UTSW	3	59077059	missense	possibly damaging	0.88
R0330:Med12l	UTSW	3	59227702	missense	probably damaging	1.00
R0388:Med12l	UTSW	3	59093504	splice site	probably benign
R0542:Med12l	UTSW	3	59042401	missense	probably damaging	1.00
R0624:Med12l	UTSW	3	59037702	nonsense	probably null
R0625:Med12l	UTSW	3	59247437	missense	probably damaging	1.00
R0671:Med12l	UTSW	3	59264929	missense	probably damaging	1.00
R0706:Med12l	UTSW	3	59261980	missense	probably damaging	1.00
R0785:Med12l	UTSW	3	59260832	missense	probably damaging	1.00
R1054:Med12l	UTSW	3	59248651	missense	probably damaging	0.99
R1102:Med12l	UTSW	3	59244836	missense	probably damaging	0.99
R1391:Med12l	UTSW	3	59037738	missense	probably benign	0.00
R1501:Med12l	UTSW	3	59260835	critical splice donor site	probably null
R1544:Med12l	UTSW	3	59265240	missense	possibly damaging	0.71
R1662:Med12l	UTSW	3	59093617	missense	probably damaging	1.00
R1670:Med12l	UTSW	3	59275958	small insertion	probably benign
R1839:Med12l	UTSW	3	59068319	missense	probably benign
R1854:Med12l	UTSW	3	59260772	missense	probably damaging	1.00
R2045:Med12l	UTSW	3	59262310	nonsense	probably null
R2070:Med12l	UTSW	3	59244905	missense	probably damaging	1.00
R2132:Med12l	UTSW	3	59265282	splice site	probably null
R2290:Med12l	UTSW	3	59244938	missense	probably damaging	1.00
R2325:Med12l	UTSW	3	59232454	missense	probably damaging	0.99
R2352:Med12l	UTSW	3	59240692	missense	probably damaging	1.00
R2484:Med12l	UTSW	3	59297838	missense	probably benign	0.18
R2906:Med12l	UTSW	3	59257082	missense	probably damaging	1.00
R3735:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3736:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3774:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R3957:Med12l	UTSW	3	59073168	missense	probably damaging	0.99
R4020:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R4087:Med12l	UTSW	3	59297921	missense	probably benign	0.00
R4233:Med12l	UTSW	3	59257223	splice site	probably null
R4235:Med12l	UTSW	3	59257223	splice site	probably null
R4236:Med12l	UTSW	3	59257223	splice site	probably null
R4327:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4328:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4346:Med12l	UTSW	3	59031555	missense	probably damaging	1.00
R4543:Med12l	UTSW	3	59091508	missense	probably damaging	1.00
R4559:Med12l	UTSW	3	59007102	critical splice donor site	probably null
R4776:Med12l	UTSW	3	59233212	missense	probably damaging	1.00
R4877:Med12l	UTSW	3	59244793	missense	probably damaging	1.00
R4983:Med12l	UTSW	3	59261929	missense	probably damaging	1.00
R5114:Med12l	UTSW	3	59259688	missense	possibly damaging	0.85
R5125:Med12l	UTSW	3	59267214	missense	possibly damaging	0.83
R5230:Med12l	UTSW	3	59245788	missense	probably damaging	1.00
R5407:Med12l	UTSW	3	59258201	missense	probably damaging	1.00
R5426:Med12l	UTSW	3	59248722	missense	probably damaging	0.98
R5439:Med12l	UTSW	3	59263213	missense	probably null	1.00
R5449:Med12l	UTSW	3	59259706	missense	probably damaging	1.00
R5596:Med12l	UTSW	3	59252350	missense	probably benign	0.45
R5716:Med12l	UTSW	3	59301377	critical splice donor site	probably null
R5833:Med12l	UTSW	3	59265226	missense	possibly damaging	0.95
R5883:Med12l	UTSW	3	59091468	missense	probably damaging	1.00
R6264:Med12l	UTSW	3	59256002	missense	probably damaging	1.00
R6269:Med12l	UTSW	3	59227822	missense	probably damaging	1.00
R6394:Med12l	UTSW	3	59235087	missense	probably damaging	1.00
R6400:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R6475:Med12l	UTSW	3	59257079	missense	probably damaging	1.00
R6489:Med12l	UTSW	3	59257407	missense	probably damaging	0.99
R6654:Med12l	UTSW	3	59262292	missense	probably damaging	1.00
R6881:Med12l	UTSW	3	59267165	missense	probably benign	0.00
R7110:Med12l	UTSW	3	59262224	missense	possibly damaging	0.92
R7134:Med12l	UTSW	3	59093759	nonsense	probably null
R7137:Med12l	UTSW	3	59258254	missense	probably damaging	1.00
R7159:Med12l	UTSW	3	59276017	missense	probably benign
R7341:Med12l	UTSW	3	59042403	missense	possibly damaging	0.53
R7349:Med12l	UTSW	3	59258325	missense	probably damaging	1.00
R7413:Med12l	UTSW	3	59091550	missense	probably benign	0.00
R7495:Med12l	UTSW	3	59244773	missense	probably damaging	1.00
R7678:Med12l	UTSW	3	59076720	missense	probably damaging	1.00
R7697:Med12l	UTSW	3	59240657	missense	probably damaging	1.00
R7714:Med12l	UTSW	3	59093586	missense	probably benign	0.17
R7725:Med12l	UTSW	3	59255992	missense	probably damaging	1.00
R7846:Med12l	UTSW	3	59264934	missense	probably damaging	1.00
R7852:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R8080:Med12l	UTSW	3	59265186	missense	probably damaging	1.00
R8181:Med12l	UTSW	3	59261968	missense	probably damaging	1.00
R8223:Med12l	UTSW	3	59086363	missense	possibly damaging	0.79
R8560:Med12l	UTSW	3	59037605	missense	probably damaging	1.00
R8708:Med12l	UTSW	3	59252330	missense	probably benign	0.00
R8865:Med12l	UTSW	3	59071882	missense	probably benign
R8947:Med12l	UTSW	3	59077022	splice site	probably benign
R8976:Med12l	UTSW	3	59275908	missense	probably damaging	0.99
R9016:Med12l	UTSW	3	59255873	missense	probably damaging	0.96
R9183:Med12l	UTSW	3	59077077	missense	probably damaging	1.00
R9487:Med12l	UTSW	3	59247932	missense	probably benign
R9526:Med12l	UTSW	3	59076786	missense	probably damaging	0.96
R9802:Med12l	UTSW	3	59261925	missense	probably damaging	1.00
RF004:Med12l	UTSW	3	59275969	small insertion	probably benign
RF011:Med12l	UTSW	3	59275980	small insertion	probably benign
RF013:Med12l	UTSW	3	59275966	small insertion	probably benign
RF020:Med12l	UTSW	3	59275958	small insertion	probably benign
RF021:Med12l	UTSW	3	59073290	missense	probably benign	0.19
RF027:Med12l	UTSW	3	59275967	small insertion	probably benign
RF027:Med12l	UTSW	3	59275981	small insertion	probably benign
RF030:Med12l	UTSW	3	59275989	small insertion	probably benign
RF032:Med12l	UTSW	3	59275981	small insertion	probably benign
RF032:Med12l	UTSW	3	59275985	small insertion	probably benign
RF032:Med12l	UTSW	3	59275989	small insertion	probably benign
RF033:Med12l	UTSW	3	59275981	small insertion	probably benign
RF033:Med12l	UTSW	3	59275987	small insertion	probably benign
RF033:Med12l	UTSW	3	59275995	small insertion	probably benign
RF037:Med12l	UTSW	3	59275956	small insertion	probably benign
RF040:Med12l	UTSW	3	59275967	small insertion	probably benign
RF040:Med12l	UTSW	3	59275989	small insertion	probably benign
RF041:Med12l	UTSW	3	59275985	small insertion	probably benign
RF041:Med12l	UTSW	3	59275995	small insertion	probably benign
RF042:Med12l	UTSW	3	59275956	small insertion	probably benign
RF042:Med12l	UTSW	3	59275967	small insertion	probably benign
RF042:Med12l	UTSW	3	59275981	small insertion	probably benign
RF042:Med12l	UTSW	3	59275995	small insertion	probably benign
RF049:Med12l	UTSW	3	59275969	small insertion	probably benign
RF050:Med12l	UTSW	3	59275973	small insertion	probably benign
RF053:Med12l	UTSW	3	59275993	small insertion	probably benign
RF055:Med12l	UTSW	3	59275983	small insertion	probably benign
RF056:Med12l	UTSW	3	59275993	small insertion	probably benign
RF057:Med12l	UTSW	3	59275980	small insertion	probably benign
RF063:Med12l	UTSW	3	59275958	small insertion	probably benign
RF063:Med12l	UTSW	3	59275973	small insertion	probably benign
X0062:Med12l	UTSW	3	59233179	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59091417	missense	probably damaging	0.98
Z1176:Med12l	UTSW	3	59244943	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59296117	missense	probably benign	0.00
Z1177:Med12l	UTSW	3	59247875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGGACGTTGAGACAGTC -3'
(R):5'- TATGAAATATCAACGGTAGCCCAAC -3'

Sequencing Primer
(F):5'- ACGTTGAGACAGTCCTGGC -3'
(R):5'- ATTCCATTCTGTCTTGTGCTACTTGG -3'

Posted On

2015-06-12