Incidental Mutation 'R4231:Sart3'
ID 320839
Institutional Source Beutler Lab
Gene Symbol Sart3
Ensembl Gene ENSMUSG00000018974
Gene Name squamous cell carcinoma antigen recognized by T cells 3
Synonyms
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R4231 (G1)
Quality Score 171
Status Validated
Chromosome 5
Chromosomal Location 113742446-113772510 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113771418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 73 (M73T)
Ref Sequence ENSEMBL: ENSMUSP00000143778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000026937] [ENSMUST00000112311] [ENSMUST00000112312] [ENSMUST00000123616] [ENSMUST00000145592] [ENSMUST00000145778] [ENSMUST00000197041]
AlphaFold Q9JLI8
Predicted Effect probably benign
Transcript: ENSMUST00000019118
AA Change: M73T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974
AA Change: M73T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026937
SMART Domains Protein: ENSMUSP00000026937
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 161 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112311
SMART Domains Protein: ENSMUSP00000107930
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 1.1e-51 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112312
SMART Domains Protein: ENSMUSP00000107931
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 3.4e-49 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123616
SMART Domains Protein: ENSMUSP00000117973
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134881
Predicted Effect probably benign
Transcript: ENSMUST00000145592
SMART Domains Protein: ENSMUSP00000123237
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
Pfam:NifU_N 32 136 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145778
Predicted Effect probably benign
Transcript: ENSMUST00000197041
AA Change: M73T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143778
Gene: ENSMUSG00000018974
AA Change: M73T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
Blast:HAT 292 323 1e-5 BLAST
HAT 325 357 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199823
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding nuclear protein that is a tumor-rejection antigen. This antigen possesses tumor epitopes capable of inducing HLA-A24-restricted and tumor-specific cytotoxic T lymphocytes in cancer patients and may be useful for specific immunotherapy. This gene product is found to be an important cellular factor for HIV-1 gene expression and viral replication. It also associates transiently with U6 and U4/U6 snRNPs during the recycling phase of the spliceosome cycle. This encoded protein is thought to be involved in the regulation of mRNA splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in hematopoietic cells exhibit protection against the effects of 5-FU treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Sart3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sart3 APN 5 113746669 missense probably benign
IGL01309:Sart3 APN 5 113759250 missense probably damaging 1.00
IGL01844:Sart3 APN 5 113745648 nonsense probably null
IGL02147:Sart3 APN 5 113762943 splice site probably benign
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0048:Sart3 UTSW 5 113755397 missense possibly damaging 0.92
R0268:Sart3 UTSW 5 113752399 missense probably damaging 0.99
R1703:Sart3 UTSW 5 113752219 missense probably benign 0.22
R1704:Sart3 UTSW 5 113746007 missense probably benign 0.14
R1998:Sart3 UTSW 5 113747921 critical splice donor site probably null
R2142:Sart3 UTSW 5 113764093 missense probably damaging 0.97
R3893:Sart3 UTSW 5 113746636 missense probably benign 0.00
R3895:Sart3 UTSW 5 113752427 nonsense probably null
R5367:Sart3 UTSW 5 113759216 splice site probably null
R5488:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5489:Sart3 UTSW 5 113771380 missense probably damaging 1.00
R5668:Sart3 UTSW 5 113745156 splice site probably null
R5903:Sart3 UTSW 5 113751239 missense probably damaging 0.98
R6046:Sart3 UTSW 5 113755446 missense probably damaging 1.00
R6173:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6215:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6216:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6221:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6222:Sart3 UTSW 5 113743206 missense probably benign 0.11
R6320:Sart3 UTSW 5 113751240 missense probably benign 0.34
R6824:Sart3 UTSW 5 113744539 splice site probably null
R6978:Sart3 UTSW 5 113745746 missense probably damaging 0.97
R7062:Sart3 UTSW 5 113745602 missense possibly damaging 0.49
R7162:Sart3 UTSW 5 113762835 missense probably damaging 1.00
R7165:Sart3 UTSW 5 113745995 missense probably benign 0.01
R7222:Sart3 UTSW 5 113746656 missense probably benign 0.01
R7235:Sart3 UTSW 5 113753642 missense probably damaging 1.00
R7237:Sart3 UTSW 5 113754246 missense possibly damaging 0.70
R7340:Sart3 UTSW 5 113744667 missense probably benign 0.02
R7580:Sart3 UTSW 5 113754379 splice site probably null
R7637:Sart3 UTSW 5 113771352 missense probably benign 0.14
R8146:Sart3 UTSW 5 113747957 missense probably damaging 0.98
R8241:Sart3 UTSW 5 113745968 missense probably benign 0.32
R8708:Sart3 UTSW 5 113744667 missense possibly damaging 0.58
R9089:Sart3 UTSW 5 113753695 missense possibly damaging 0.63
R9106:Sart3 UTSW 5 113754349 missense possibly damaging 0.90
R9312:Sart3 UTSW 5 113762874 missense possibly damaging 0.81
X0058:Sart3 UTSW 5 113745928 missense probably benign
Z1176:Sart3 UTSW 5 113745824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCGGTCTCCATAACCAC -3'
(R):5'- GAGTTTTGATCAGGCAGACGC -3'

Sequencing Primer
(F):5'- TCCATAACCACGGAGGACC -3'
(R):5'- ACGACGGCCGCATCTTC -3'
Posted On 2015-06-12