Mutagenetix > Incidental Mutations

Incidental Mutation 'R4231:Rnf216'

320842

Institutional Source

Beutler Lab

Gene Symbol

Rnf216

Ensembl Gene

ENSMUSG00000045078

Gene Name

ring finger protein 216

Synonyms

2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83

MMRRC Submission

041050-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142990893-143112994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 143093090 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 35 (S35T)

Ref Sequence

ENSEMBL: ENSMUSP00000143242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]

AlphaFold

P58283

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053498
AA Change: S35T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: S35T

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197296
AA Change: S35T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200002

Predicted Effect

probably benign
Transcript: ENSMUST00000200430

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200607
AA Change: S35T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: S35T

Domain	Start	End	E-Value	Type
Blast:RING	560	620	4e-6	BLAST
IBR	629	693	6.82e-5	SMART
IBR	702	769	1.79e-1	SMART
low complexity region	786	803	N/A	INTRINSIC
low complexity region	842	866	N/A	INTRINSIC
low complexity region	869	881	N/A	INTRINSIC

Meta Mutation Damage Score

0.0757

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tex15	T	C	8: 33,572,137	S806P	probably damaging	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Rnf216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Rnf216	APN	5	143068910	missense	possibly damaging	0.67
IGL02502:Rnf216	APN	5	143068867	missense	probably damaging	1.00
IGL02536:Rnf216	APN	5	143080240	missense	probably benign	0.04
IGL03196:Rnf216	APN	5	143081011	missense	probably damaging	1.00
PIT4445001:Rnf216	UTSW	5	143086003	missense	probably damaging	1.00
R0270:Rnf216	UTSW	5	143080241	missense	possibly damaging	0.63
R0422:Rnf216	UTSW	5	143015654	nonsense	probably null
R0422:Rnf216	UTSW	5	143090370	missense	probably benign	0.15
R0782:Rnf216	UTSW	5	143068892	missense	possibly damaging	0.64
R1109:Rnf216	UTSW	5	143068369	missense	probably damaging	1.00
R1917:Rnf216	UTSW	5	142992806	missense	probably benign	0.03
R2233:Rnf216	UTSW	5	143090926	missense	probably benign
R2234:Rnf216	UTSW	5	143090926	missense	probably benign
R2235:Rnf216	UTSW	5	143090926	missense	probably benign
R2340:Rnf216	UTSW	5	143080334	missense	probably damaging	0.99
R3015:Rnf216	UTSW	5	143075725	critical splice donor site	probably null
R3726:Rnf216	UTSW	5	143027946	missense	probably damaging	0.96
R4885:Rnf216	UTSW	5	143090580	nonsense	probably null
R4942:Rnf216	UTSW	5	143093059	missense	probably damaging	1.00
R4973:Rnf216	UTSW	5	143090316	missense	probably benign
R5291:Rnf216	UTSW	5	143090212	missense	probably benign
R5307:Rnf216	UTSW	5	143093002	missense	probably damaging	1.00
R5328:Rnf216	UTSW	5	143092999	missense	possibly damaging	0.84
R5416:Rnf216	UTSW	5	143015771	nonsense	probably null
R5888:Rnf216	UTSW	5	143068314	splice site	probably null
R6048:Rnf216	UTSW	5	143068904	missense	probably damaging	1.00
R6451:Rnf216	UTSW	5	142992834	missense	possibly damaging	0.80
R6595:Rnf216	UTSW	5	143090657	missense	probably benign	0.00
R7422:Rnf216	UTSW	5	143090836	missense	probably benign	0.01
R7470:Rnf216	UTSW	5	142992725	missense	possibly damaging	0.88
R7504:Rnf216	UTSW	5	143075759	missense	probably benign	0.27
R7507:Rnf216	UTSW	5	143089802	missense	probably damaging	1.00
R7695:Rnf216	UTSW	5	143085904	missense	possibly damaging	0.80
R7757:Rnf216	UTSW	5	143080236	missense	probably damaging	1.00
R7768:Rnf216	UTSW	5	143098444	start codon destroyed	probably null	1.00
R8056:Rnf216	UTSW	5	142992861	missense	probably benign	0.02
R8081:Rnf216	UTSW	5	143027964	missense	probably damaging	0.98
R8985:Rnf216	UTSW	5	143090425	missense	probably benign	0.16
Z1176:Rnf216	UTSW	5	143098443	start codon destroyed	probably null	0.99
Z1177:Rnf216	UTSW	5	142992807	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACCACATAGAGCGTTAAAGC -3'
(R):5'- AGAATCTCAGGCATGCACCC -3'

Sequencing Primer
(F):5'- CGTTAAAGCTAAAACACAAGAGGC -3'
(R):5'- TTCTCCCACCTAACATAAAGAGTTG -3'

Posted On

2015-06-12