Incidental Mutation 'R4231:Xpo6'
ID 320845
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Name exportin 6
Synonyms 2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock # R4231 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126101715-126200501 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126174182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 24 (T24A)
Ref Sequence ENSEMBL: ENSMUSP00000132462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000163959] [ENSMUST00000167147] [ENSMUST00000168189]
AlphaFold Q924Z6
Predicted Effect probably benign
Transcript: ENSMUST00000009344
AA Change: T24A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: T24A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166368
Predicted Effect possibly damaging
Transcript: ENSMUST00000167147
AA Change: T24A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167268
Predicted Effect probably benign
Transcript: ENSMUST00000168189
AA Change: T24A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: T24A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169993
Meta Mutation Damage Score 0.0994 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Anthracite UTSW 7 126102333 nonsense probably null
Bituminous UTSW 7 126112955 splice site probably benign
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R1671:Xpo6 UTSW 7 126108543 missense possibly damaging 0.92
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4569:Xpo6 UTSW 7 126128255 missense probably damaging 1.00
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6256:Xpo6 UTSW 7 126108619 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7480:Xpo6 UTSW 7 126102333 nonsense probably null
R7630:Xpo6 UTSW 7 126140389 splice site probably null
R7794:Xpo6 UTSW 7 126160863 missense probably damaging 0.98
R7984:Xpo6 UTSW 7 126120444 missense probably benign
R8022:Xpo6 UTSW 7 126169254 missense probably benign 0.04
R8283:Xpo6 UTSW 7 126128249 missense possibly damaging 0.90
R8438:Xpo6 UTSW 7 126160882 missense possibly damaging 0.71
R8786:Xpo6 UTSW 7 126112955 splice site probably benign
R9427:Xpo6 UTSW 7 126149246
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCCAATCACTATGCTAGGTG -3'
(R):5'- TGTAGGAGATACTAAAGTTGGCTTC -3'

Sequencing Primer
(F):5'- CCAATCACTATGCTAGGTGTGCAAG -3'
(R):5'- GCTTCTAAGCCAGATGGAAATTTTC -3'
Posted On 2015-06-12