Incidental Mutation 'R4231:Olfr53'
ID 320846
Institutional Source Beutler Lab
Gene Symbol Olfr53
Ensembl Gene ENSMUSG00000094819
Gene Name olfactory receptor 53
Synonyms GA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4231 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140646452-140653085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140652740 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 254 (Y254H)
Ref Sequence ENSEMBL: ENSMUSP00000081494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084456] [ENSMUST00000211057] [ENSMUST00000211399]
AlphaFold Q8VGL8
Predicted Effect probably damaging
Transcript: ENSMUST00000084456
AA Change: Y254H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081494
Gene: ENSMUSG00000094819
AA Change: Y254H

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 37 208 9.7e-7 PFAM
Pfam:7tm_1 43 292 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211057
Predicted Effect probably benign
Transcript: ENSMUST00000211399
Meta Mutation Damage Score 0.3746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Olfr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr53 APN 7 140652476 missense probably benign 0.00
IGL01071:Olfr53 APN 7 140652914 missense possibly damaging 0.76
IGL02590:Olfr53 APN 7 140652392 splice site probably null
IGL02694:Olfr53 APN 7 140652180 missense probably damaging 0.99
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0089:Olfr53 UTSW 7 140652311 missense probably damaging 0.99
R0586:Olfr53 UTSW 7 140652063 missense probably benign 0.35
R1209:Olfr53 UTSW 7 140652014 missense probably benign 0.03
R1491:Olfr53 UTSW 7 140652737 missense probably damaging 1.00
R1781:Olfr53 UTSW 7 140652506 missense probably damaging 0.99
R4060:Olfr53 UTSW 7 140652120 missense probably damaging 1.00
R4236:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4299:Olfr53 UTSW 7 140652243 missense probably benign 0.00
R4398:Olfr53 UTSW 7 140652828 missense possibly damaging 0.65
R4675:Olfr53 UTSW 7 140652161 missense probably damaging 1.00
R4937:Olfr53 UTSW 7 140652621 missense probably benign 0.00
R5854:Olfr53 UTSW 7 140652578 missense probably benign 0.03
R6124:Olfr53 UTSW 7 140652594 missense probably damaging 1.00
R7092:Olfr53 UTSW 7 140652237 missense probably benign 0.16
R7167:Olfr53 UTSW 7 140652553 nonsense probably null
R7846:Olfr53 UTSW 7 140652461 missense probably damaging 0.96
R7896:Olfr53 UTSW 7 140652901 missense probably benign 0.00
R8080:Olfr53 UTSW 7 140652474 missense probably benign 0.05
R8847:Olfr53 UTSW 7 140652413 missense possibly damaging 0.80
R8926:Olfr53 UTSW 7 140652200 missense probably benign 0.03
R9391:Olfr53 UTSW 7 140652359 missense probably damaging 0.99
R9414:Olfr53 UTSW 7 140652350
Z1177:Olfr53 UTSW 7 140652787 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCCACTTCTTCTGTGAGATAC -3'
(R):5'- GAAAGAGGCCAACATCCTGC -3'

Sequencing Primer
(F):5'- TGTGAGATACCCCCACTCC -3'
(R):5'- CCCAAGGCAAGCTTGACATC -3'
Posted On 2015-06-12