Incidental Mutation 'R4231:Arhgef18'
ID 320847
Institutional Source Beutler Lab
Gene Symbol Arhgef18
Ensembl Gene ENSMUSG00000004568
Gene Name rho/rac guanine nucleotide exchange factor (GEF) 18
Synonyms D030053O22Rik
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4231 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3393006-3456601 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3450317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 541 (I541T)
Ref Sequence ENSEMBL: ENSMUSP00000004684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000004684
AA Change: I541T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568
AA Change: I541T

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156085
Meta Mutation Damage Score 0.1480 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably benign Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Arhgef18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Arhgef18 APN 8 3429553 missense probably damaging 1.00
IGL01649:Arhgef18 APN 8 3441211 splice site probably benign
IGL01736:Arhgef18 APN 8 3451624 splice site probably benign
IGL02206:Arhgef18 APN 8 3445034 missense probably benign 0.00
IGL02401:Arhgef18 APN 8 3437078 missense probably damaging 1.00
IGL02938:Arhgef18 APN 8 3450802 missense probably benign 0.02
IGL02943:Arhgef18 APN 8 3448553 missense probably damaging 0.99
IGL02990:Arhgef18 APN 8 3444904 missense probably benign 0.02
IGL03162:Arhgef18 APN 8 3441301 splice site probably null
R1622:Arhgef18 UTSW 8 3441272 missense possibly damaging 0.46
R1681:Arhgef18 UTSW 8 3439645 missense probably damaging 1.00
R1726:Arhgef18 UTSW 8 3454228 missense possibly damaging 0.46
R2126:Arhgef18 UTSW 8 3451939 missense probably damaging 0.99
R2161:Arhgef18 UTSW 8 3439575 nonsense probably null
R2878:Arhgef18 UTSW 8 3432759 missense probably benign
R3916:Arhgef18 UTSW 8 3454197 missense probably benign
R4233:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4234:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4235:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4236:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4450:Arhgef18 UTSW 8 3437097 missense probably damaging 0.97
R4539:Arhgef18 UTSW 8 3447070 missense probably benign
R4670:Arhgef18 UTSW 8 3434897 missense probably damaging 1.00
R4753:Arhgef18 UTSW 8 3444938 missense probably damaging 1.00
R4897:Arhgef18 UTSW 8 3444979 missense probably benign
R5313:Arhgef18 UTSW 8 3451629 critical splice acceptor site probably null
R5698:Arhgef18 UTSW 8 3439499 missense probably damaging 0.99
R5781:Arhgef18 UTSW 8 3439439 splice site probably null
R5851:Arhgef18 UTSW 8 3434980 missense probably damaging 1.00
R5897:Arhgef18 UTSW 8 3439682 missense probably damaging 1.00
R5908:Arhgef18 UTSW 8 3453165 missense probably damaging 1.00
R6123:Arhgef18 UTSW 8 3437091 missense probably damaging 0.99
R6136:Arhgef18 UTSW 8 3454507 missense probably benign
R6240:Arhgef18 UTSW 8 3439658 missense probably damaging 1.00
R6617:Arhgef18 UTSW 8 3439592 missense probably damaging 1.00
R7575:Arhgef18 UTSW 8 3451635 missense probably damaging 0.99
R7851:Arhgef18 UTSW 8 3448409 missense possibly damaging 0.46
R7947:Arhgef18 UTSW 8 3432775 missense probably damaging 1.00
R8030:Arhgef18 UTSW 8 3439600 missense probably damaging 1.00
R8848:Arhgef18 UTSW 8 3427481 missense probably benign 0.00
R9038:Arhgef18 UTSW 8 3453257 missense probably benign 0.30
R9131:Arhgef18 UTSW 8 3437007 missense possibly damaging 0.77
R9229:Arhgef18 UTSW 8 3429314 missense probably benign 0.01
X0021:Arhgef18 UTSW 8 3434942 missense probably damaging 1.00
Z1088:Arhgef18 UTSW 8 3439628 missense probably damaging 1.00
Z1176:Arhgef18 UTSW 8 3453224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATGGCTGCCTGATTG -3'
(R):5'- TAACACTGGATCTGCTGCGC -3'

Sequencing Primer
(F):5'- CTCTCCCTTAGATGCTGAGGATG -3'
(R):5'- GATCTGCTGCGCATGGG -3'
Posted On 2015-06-12