Mutagenetix > Incidental Mutation

Incidental Mutation 'R4231:Tex15'

320849

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

041050-MU

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Essential gene?

Possibly non essential (E-score: 0.291) question?

Stock #

R4231 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33572137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 806 (S806P)

Ref Sequence

ENSEMBL: ENSMUSP00000120744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000009772
AA Change: S532P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: S532P

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000124496
AA Change: S806P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: S806P

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

99% (75/76)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
4932438A13Rik	C	T	3: 36,920,236	T663I	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	A	T	12: 53,141,038	D1745V	probably damaging	Het
Aldh5a1	C	T	13: 24,911,653	G494R	probably damaging	Het
Ankar	T	C	1: 72,658,542	D1034G	probably benign	Het
Aox3	T	A	1: 58,114,885	N23K	probably benign	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Cacnb2	A	G	2: 14,981,440	K343E	probably damaging	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Cd93	A	T	2: 148,442,960	H155Q	probably benign	Het
Cox6b2	T	C	7: 4,752,835	M1V	probably null	Het
Crat	T	C	2: 30,413,011	E88G	possibly damaging	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dip2a	G	A	10: 76,319,470	P94S	probably damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Fam196b	A	T	11: 34,403,143	E395V	probably benign	Het
Filip1l	T	C	16: 57,506,768	S54P	probably benign	Het
Gm12887	A	T	4: 121,622,102	M1K	probably null	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Irak2	A	G	6: 113,690,856	E466G	probably damaging	Het
Irgm2	C	T	11: 58,219,478		probably benign	Het
Jak3	T	A	8: 71,685,545	V880D	probably damaging	Het
Jmy	G	T	13: 93,498,925	P128T	probably benign	Het
Kif20a	A	G	18: 34,632,038	N775S	probably benign	Het
Kremen1	G	A	11: 5,243,881	Q50*	probably null	Het
Lrrc71	A	G	3: 87,740,991	I438T	probably benign	Het
Map3k1	T	C	13: 111,768,494	T374A	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mta1	T	C	12: 113,135,827	M603T	possibly damaging	Het
Myo5a	A	G	9: 75,189,997	N1319S	possibly damaging	Het
Nalcn	T	A	14: 123,599,913	Q13L	probably benign	Het
Nbas	A	G	12: 13,393,343	N1133S	probably damaging	Het
Nsun2	A	G	13: 69,619,541	N205D	probably damaging	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr1293-ps	C	T	2: 111,528,201	R314C	probably damaging	Het
Olfr53	T	C	7: 140,652,740	Y254H	probably damaging	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	G	1: 97,884,124		probably null	Het
Pcdh7	G	A	5: 57,719,289	G62D	possibly damaging	Het
Plxna2	C	T	1: 194,644,454	T232I	probably damaging	Het
Prkar1b	A	G	5: 139,108,621	S71P	probably benign	Het
Ptprq	A	T	10: 107,686,283	Y602*	probably null	Het
Rfx4	A	T	10: 84,814,694	M84L	probably benign	Het
Rfx7	A	T	9: 72,619,390	E1287D	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rnf216	A	T	5: 143,093,090	S35T	probably damaging	Het
Rps6kc1	A	G	1: 190,808,900	V402A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sart3	A	G	5: 113,771,418	M73T	probably benign	Het
Scn10a	G	T	9: 119,631,544	T1088K	probably damaging	Het
Senp2	T	C	16: 22,011,554		probably null	Het
Setd7	T	C	3: 51,542,730	N92D	probably benign	Het
Sipa1	A	T	19: 5,654,089	L735Q	probably damaging	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slitrk6	A	T	14: 110,751,388	S296T	probably benign	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Tgm3	A	T	2: 130,044,589	K577*	probably null	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Xpo6	T	C	7: 126,174,182	T24A	possibly damaging	Het
Zfhx2	A	G	14: 55,073,534	C568R	possibly damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
R9618:Tex15	UTSW	8	33572369	missense	probably benign	0.35
R9655:Tex15	UTSW	8	33576756	nonsense	probably null
R9786:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R9798:Tex15	UTSW	8	33572693	missense	probably damaging	0.98
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GTGCAGCATTGGAATTAGAGTG -3'
(R):5'- GATCACAGCTCAATTCTGCATC -3'

Sequencing Primer
(F):5'- GCAACACTCTTTGGAGCATG -3'
(R):5'- CATAAGATAGGCTGTGATCCTGCAC -3'

Posted On

2015-06-12