Incidental Mutation 'R4232:Cflar'
ID320887
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene NameCASP8 and FADD-like apoptosis regulator
SynonymsFlip, 2310024N18Rik, A430105C05Rik, Cash, Casper, c-Flip
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58711508-58758884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58740993 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 249 (Q249L)
Ref Sequence ENSEMBL: ENSMUSP00000109952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069333
AA Change: Q249L

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: Q249L

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097722
AA Change: Q252L

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: Q252L

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114313
AA Change: Q249L

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: Q249L

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140940
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58732310 missense probably benign 0.42
IGL00959:Cflar APN 1 58729162 critical splice donor site probably null
IGL02045:Cflar APN 1 58752744 missense probably benign 0.25
IGL02200:Cflar APN 1 58752669 missense probably damaging 1.00
IGL02382:Cflar APN 1 58752681 missense probably benign 0.14
IGL03032:Cflar APN 1 58741020 missense probably damaging 1.00
Channel_islands UTSW 1 58753851 missense probably benign 0.00
IGL02988:Cflar UTSW 1 58741031 missense possibly damaging 0.58
R1936:Cflar UTSW 1 58752625 nonsense probably null
R2259:Cflar UTSW 1 58729121 missense probably benign 0.16
R2269:Cflar UTSW 1 58741047 critical splice donor site probably null
R3816:Cflar UTSW 1 58752423 missense probably benign 0.24
R3824:Cflar UTSW 1 58735697 missense probably benign 0.00
R4644:Cflar UTSW 1 58731267 missense probably damaging 1.00
R4749:Cflar UTSW 1 58740272 missense possibly damaging 0.62
R4765:Cflar UTSW 1 58732321 missense probably damaging 0.98
R4785:Cflar UTSW 1 58752567 missense probably benign 0.34
R5315:Cflar UTSW 1 58753802 missense probably benign 0.34
R5418:Cflar UTSW 1 58752651 missense possibly damaging 0.54
R5509:Cflar UTSW 1 58752392 missense probably benign 0.02
R5858:Cflar UTSW 1 58753851 missense probably benign 0.00
R5899:Cflar UTSW 1 58752768 missense probably benign 0.36
R6048:Cflar UTSW 1 58741043 missense probably benign 0.02
R7065:Cflar UTSW 1 58731209 missense probably damaging 1.00
R7144:Cflar UTSW 1 58753848 missense
R7206:Cflar UTSW 1 58740991 missense
R7384:Cflar UTSW 1 58752576 missense
R7453:Cflar UTSW 1 58753797 missense
R7467:Cflar UTSW 1 58726438 start codon destroyed probably null
R7694:Cflar UTSW 1 58752807 missense
R7808:Cflar UTSW 1 58711581 start gained probably benign
R7890:Cflar UTSW 1 58752756 missense
R7973:Cflar UTSW 1 58752756 missense
Predicted Primers PCR Primer
(F):5'- GAACTGTCAGCCGTGATGAC -3'
(R):5'- CAACTTCCACAACTTAAAGCTAGTG -3'

Sequencing Primer
(F):5'- AACTGTCAGCCGTGATGACTTTAG -3'
(R):5'- TGTGATGAGATCCGCTACAC -3'
Posted On2015-06-12