Incidental Mutation 'R4232:Dnajb3'
ID320889
Institutional Source Beutler Lab
Gene Symbol Dnajb3
Ensembl Gene ENSMUSG00000081984
Gene NameDnaJ heat shock protein family (Hsp40) member B3
SynonymsMSJ-1, Hsj3, Msj1
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location88204732-88205782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88205252 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 143 (S143P)
Ref Sequence ENSEMBL: ENSMUSP00000112703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000119972] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119972
AA Change: S143P

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112703
Gene: ENSMUSG00000081984
AA Change: S143P

DomainStartEndE-ValueType
DnaJ 2 61 6.22e-33 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Dnajb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Dnajb3 APN 1 88205382 missense probably benign 0.00
IGL02489:Dnajb3 APN 1 88205310 missense probably benign 0.37
IGL02726:Dnajb3 APN 1 88205650 missense probably damaging 1.00
IGL02733:Dnajb3 APN 1 88204940 intron probably benign
IGL02867:Dnajb3 APN 1 88205527 missense probably benign 0.43
R1235:Dnajb3 UTSW 1 88205479 missense probably benign 0.03
R3154:Dnajb3 UTSW 1 88205051 missense probably benign 0.22
R4718:Dnajb3 UTSW 1 88205339 missense probably benign 0.13
R5033:Dnajb3 UTSW 1 88205023 missense possibly damaging 0.94
R6393:Dnajb3 UTSW 1 88205662 missense possibly damaging 0.64
R6980:Dnajb3 UTSW 1 88205014 missense probably damaging 1.00
R7789:Dnajb3 UTSW 1 88205677 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGACTTTAACTCTCCATC -3'
(R):5'- ACGATGCCTTCCAGTACGTC -3'

Sequencing Primer
(F):5'- ATTCTCAACGATTCTCTTGGTGG -3'
(R):5'- AGTACGTCTTCTCCTTCCGAG -3'
Posted On2015-06-12