Mutagenetix > Incidental Mutations

Incidental Mutation 'R4232:Arhgap21'

320893

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

041051-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.515) question?

Stock #

R4232 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20887137 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 161 (V161A)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000140230] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114594
AA Change: V155A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: V155A

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140230

SMART Domains

Protein: ENSMUSP00000122271
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	65	145	3.4e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141298
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154230
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156142

Predicted Effect

probably damaging
Transcript: ENSMUST00000173194
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.5836

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

92% (58/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Aven	A	G	2: 112,627,768	D167G	probably damaging	Het
Celsr2	A	G	3: 108,413,772	F575L	probably benign	Het
Cflar	A	T	1: 58,740,993	Q249L	possibly damaging	Het
Col7a1	G	A	9: 108,972,813		probably null	Het
Dmxl2	T	C	9: 54,419,909	D944G	possibly damaging	Het
Dnah1	T	C	14: 31,304,916	N717S	probably benign	Het
Dnaja3	T	A	16: 4,699,871	N322K	possibly damaging	Het
Dnajb3	A	G	1: 88,205,252	S143P	possibly damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Dvl3	A	G	16: 20,524,233		probably benign	Het
Fam71b	C	A	11: 46,407,405	T512K	possibly damaging	Het
Fkbp7	A	T	2: 76,663,317	D177E	possibly damaging	Het
Galnt7	T	C	8: 57,652,966	I5V	probably benign	Het
Helz2	A	T	2: 181,229,902	L2639Q	probably damaging	Het
Hnrnpr	T	C	4: 136,339,189	M394T	probably benign	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kif14	T	A	1: 136,516,363	C1364*	probably null	Het
Macf1	T	C	4: 123,432,392	E5104G	probably damaging	Het
Mkl1	T	A	15: 81,023,595	K29M	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mtbp	CATGA	CATGAATGA	15: 55,620,677		probably null	Het
Nfkb1	A	G	3: 135,603,770	V521A	probably damaging	Het
Olfr1535	T	C	13: 21,555,461	D187G	probably damaging	Het
Olfr850	G	T	9: 19,477,726	L175M	probably damaging	Het
P2rx6	T	C	16: 17,570,767	L335P	probably damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Pgpep1l	T	C	7: 68,237,079	T161A	probably benign	Het
Prss40	A	G	1: 34,560,792	V38A	probably benign	Het
Ptk2	C	A	15: 73,309,849	R104L	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rtp4	A	G	16: 23,613,083	N122D	possibly damaging	Het
Samd8	A	G	14: 21,780,145	Y213C	probably benign	Het
Shcbp1	T	A	8: 4,736,372	T577S	probably benign	Het
Tiprl	A	G	1: 165,222,587	V153A	probably damaging	Het
Tmprss7	A	T	16: 45,656,573	D775E	probably damaging	Het
Tnr	T	C	1: 159,886,215	S738P	possibly damaging	Het
Tsc22d4	T	C	5: 137,751,370		probably null	Het
Ttc21a	A	T	9: 119,942,618	H161L	probably benign	Het
Ubqln3	T	A	7: 104,141,803	E360V	probably benign	Het
Ugt1a10	C	A	1: 88,056,210	D243E	probably benign	Het
Vmn2r19	G	A	6: 123,329,912	V460I	probably benign	Het
Vmn2r58	T	A	7: 41,837,587	Y628F	possibly damaging	Het
Wnk1	A	T	6: 119,949,261	S1588T	possibly damaging	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Zfp831	G	C	2: 174,705,654	W1543C	possibly damaging	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20880510	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20865387	missense	probably benign
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20849196	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20863156	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20880405	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20849410	missense	probably benign
R8486:Arhgap21	UTSW	2	20860425	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20881305	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20854180	missense	probably benign	0.17
Z1191:Arhgap21	UTSW	2	20881472	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TTGTGGACAACAATCTGTCTCTTG -3'
(R):5'- ACGTTGTAATGAGCCGTACG -3'

Sequencing Primer
(F):5'- AGTGAACCAGGAGGGTTT -3'
(R):5'- CGTTGTAATGAGCCGTACGATCAC -3'

Posted On

2015-06-12