Incidental Mutation 'R4232:Fkbp7'
ID320894
Institutional Source Beutler Lab
Gene Symbol Fkbp7
Ensembl Gene ENSMUSG00000002732
Gene NameFK506 binding protein 7
SynonymsFKBP23
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76663044-76673116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76663317 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 177 (D177E)
Ref Sequence ENSEMBL: ENSMUSP00000002809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002809] [ENSMUST00000099986] [ENSMUST00000176815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002809
AA Change: D177E

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002809
Gene: ENSMUSG00000002732
AA Change: D177E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 42 138 7e-31 PFAM
EFh 145 173 1.83e1 SMART
EFh 189 217 5.38e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099986
SMART Domains Protein: ENSMUSP00000097566
Gene: ENSMUSG00000075267

DomainStartEndE-ValueType
Pfam:Gasdermin 1 278 7.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154097
Predicted Effect probably benign
Transcript: ENSMUST00000176815
SMART Domains Protein: ENSMUSP00000135000
Gene: ENSMUSG00000002732

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:FKBP_C 42 123 3.6e-22 PFAM
Meta Mutation Damage Score 0.0854 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the FKBP-type peptidyl-prolyl cis/trans isomerase (PPIase) family. Members of this family exhibit PPIase activity and function as molecular chaperones. A similar protein in mouse is located in the endoplasmic reticulum and binds calcium. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Fkbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Fkbp7 APN 2 76672908 nonsense probably null
R0384:Fkbp7 UTSW 2 76665824 splice site probably benign
R0627:Fkbp7 UTSW 2 76672844 missense probably damaging 1.00
R3981:Fkbp7 UTSW 2 76663257 missense probably damaging 1.00
R4679:Fkbp7 UTSW 2 76671688 splice site probably benign
R5495:Fkbp7 UTSW 2 76663294 missense probably damaging 1.00
R6703:Fkbp7 UTSW 2 76671762 missense probably damaging 1.00
R7296:Fkbp7 UTSW 2 76671764 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTCTCACAAGGGAAAACAGGTATAACC -3'
(R):5'- TGTCCTTGCCCCATAAACAATTAG -3'

Sequencing Primer
(F):5'- TATAACCACAACATAGAGAACGGTG -3'
(R):5'- CCATGCTTATTCATTACTGTAATC -3'
Posted On2015-06-12