Mutagenetix > Incidental Mutations

Incidental Mutation 'R4232:Zfp831'

320897

Institutional Source

Beutler Lab

Gene Symbol

Zfp831

Ensembl Gene

ENSMUSG00000050600

Gene Name

zinc finger protein 831

Synonyms

ENSMUSG00000050600, OTTMUSG00000017459

MMRRC Submission

041051-MU

Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4232 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

174643534-174710832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 174705654 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Cysteine at position 1543 (W1543C)

Ref Sequence

ENSEMBL: ENSMUSP00000060255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059452]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059452
AA Change: W1543C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: W1543C

Domain	Start	End	E-Value	Type
low complexity region	120	135	N/A	INTRINSIC
ZnF_C2H2	143	165	5.06e-2	SMART
ZnF_C2H2	171	195	7.78e-3	SMART
low complexity region	201	216	N/A	INTRINSIC
low complexity region	237	248	N/A	INTRINSIC
low complexity region	345	371	N/A	INTRINSIC
low complexity region	383	392	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
low complexity region	645	657	N/A	INTRINSIC
low complexity region	717	736	N/A	INTRINSIC
low complexity region	856	870	N/A	INTRINSIC
low complexity region	1520	1529	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

92% (58/63)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Aven	A	G	2: 112,627,768	D167G	probably damaging	Het
Celsr2	A	G	3: 108,413,772	F575L	probably benign	Het
Cflar	A	T	1: 58,740,993	Q249L	possibly damaging	Het
Col7a1	G	A	9: 108,972,813		probably null	Het
Dmxl2	T	C	9: 54,419,909	D944G	possibly damaging	Het
Dnah1	T	C	14: 31,304,916	N717S	probably benign	Het
Dnaja3	T	A	16: 4,699,871	N322K	possibly damaging	Het
Dnajb3	A	G	1: 88,205,252	S143P	possibly damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Dvl3	A	G	16: 20,524,233		probably benign	Het
Fam71b	C	A	11: 46,407,405	T512K	possibly damaging	Het
Fkbp7	A	T	2: 76,663,317	D177E	possibly damaging	Het
Galnt7	T	C	8: 57,652,966	I5V	probably benign	Het
Helz2	A	T	2: 181,229,902	L2639Q	probably damaging	Het
Hnrnpr	T	C	4: 136,339,189	M394T	probably benign	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kif14	T	A	1: 136,516,363	C1364*	probably null	Het
Macf1	T	C	4: 123,432,392	E5104G	probably damaging	Het
Mkl1	T	A	15: 81,023,595	K29M	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mtbp	CATGA	CATGAATGA	15: 55,620,677		probably null	Het
Nfkb1	A	G	3: 135,603,770	V521A	probably damaging	Het
Olfr1535	T	C	13: 21,555,461	D187G	probably damaging	Het
Olfr850	G	T	9: 19,477,726	L175M	probably damaging	Het
P2rx6	T	C	16: 17,570,767	L335P	probably damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Pgpep1l	T	C	7: 68,237,079	T161A	probably benign	Het
Prss40	A	G	1: 34,560,792	V38A	probably benign	Het
Ptk2	C	A	15: 73,309,849	R104L	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rtp4	A	G	16: 23,613,083	N122D	possibly damaging	Het
Samd8	A	G	14: 21,780,145	Y213C	probably benign	Het
Shcbp1	T	A	8: 4,736,372	T577S	probably benign	Het
Tiprl	A	G	1: 165,222,587	V153A	probably damaging	Het
Tmprss7	A	T	16: 45,656,573	D775E	probably damaging	Het
Tnr	T	C	1: 159,886,215	S738P	possibly damaging	Het
Tsc22d4	T	C	5: 137,751,370		probably null	Het
Ttc21a	A	T	9: 119,942,618	H161L	probably benign	Het
Ubqln3	T	A	7: 104,141,803	E360V	probably benign	Het
Ugt1a10	C	A	1: 88,056,210	D243E	probably benign	Het
Vmn2r19	G	A	6: 123,329,912	V460I	probably benign	Het
Vmn2r58	T	A	7: 41,837,587	Y628F	possibly damaging	Het
Wnk1	A	T	6: 119,949,261	S1588T	possibly damaging	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het

Other mutations in Zfp831

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Zfp831	APN	2	174646285	missense	possibly damaging	0.86
IGL00091:Zfp831	APN	2	174645658	missense	possibly damaging	0.73
IGL00764:Zfp831	APN	2	174645908	missense	possibly damaging	0.72
IGL01538:Zfp831	APN	2	174644606	missense	possibly damaging	0.72
IGL01700:Zfp831	APN	2	174644918	missense	possibly damaging	0.86
IGL01718:Zfp831	APN	2	174643838	missense	possibly damaging	0.86
IGL02221:Zfp831	APN	2	174643726	missense	probably benign	0.33
IGL02250:Zfp831	APN	2	174648201	missense	possibly damaging	0.53
IGL03209:Zfp831	APN	2	174645266	missense	probably benign	0.40
D4043:Zfp831	UTSW	2	174645266	missense	probably benign	0.40
FR4304:Zfp831	UTSW	2	174645481	small insertion	probably benign
FR4340:Zfp831	UTSW	2	174645480	small insertion	probably benign
FR4449:Zfp831	UTSW	2	174645471	small insertion	probably benign
FR4449:Zfp831	UTSW	2	174645482	small insertion	probably benign
FR4589:Zfp831	UTSW	2	174645468	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645471	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645476	small insertion	probably benign
FR4737:Zfp831	UTSW	2	174645483	small insertion	probably benign
IGL02802:Zfp831	UTSW	2	174645152	missense	possibly damaging	0.73
P0028:Zfp831	UTSW	2	174645346	missense	possibly damaging	0.53
PIT4531001:Zfp831	UTSW	2	174646723	missense	possibly damaging	0.90
R0631:Zfp831	UTSW	2	174645290	missense	possibly damaging	0.53
R0644:Zfp831	UTSW	2	174645863	missense	probably benign	0.33
R0782:Zfp831	UTSW	2	174646630	missense	probably benign	0.06
R1156:Zfp831	UTSW	2	174646917	missense	possibly damaging	0.53
R1280:Zfp831	UTSW	2	174704059	missense	probably benign	0.00
R1709:Zfp831	UTSW	2	174645890	missense	probably benign	0.33
R1883:Zfp831	UTSW	2	174704077	missense	possibly damaging	0.53
R1884:Zfp831	UTSW	2	174704077	missense	possibly damaging	0.53
R2127:Zfp831	UTSW	2	174648124	missense	probably benign	0.33
R2137:Zfp831	UTSW	2	174705746	missense	possibly damaging	0.53
R2268:Zfp831	UTSW	2	174644241	missense	probably benign	0.01
R2330:Zfp831	UTSW	2	174648089	nonsense	probably null
R3547:Zfp831	UTSW	2	174657683	missense	probably benign
R3821:Zfp831	UTSW	2	174644023	missense	possibly damaging	0.73
R4163:Zfp831	UTSW	2	174644029	missense	possibly damaging	0.53
R4778:Zfp831	UTSW	2	174646807	missense	possibly damaging	0.53
R4820:Zfp831	UTSW	2	174705304	missense	possibly damaging	0.73
R4912:Zfp831	UTSW	2	174644624	missense	probably damaging	1.00
R5119:Zfp831	UTSW	2	174705310	missense	probably benign	0.18
R5152:Zfp831	UTSW	2	174644564	missense	probably benign	0.33
R5723:Zfp831	UTSW	2	174645407	missense	probably benign	0.23
R5741:Zfp831	UTSW	2	174645152	missense	possibly damaging	0.73
R5888:Zfp831	UTSW	2	174643627	missense	probably benign	0.18
R5975:Zfp831	UTSW	2	174644092	missense	possibly damaging	0.93
R6092:Zfp831	UTSW	2	174705506	missense	probably damaging	0.98
R6158:Zfp831	UTSW	2	174643858	missense	possibly damaging	0.53
R6212:Zfp831	UTSW	2	174645868	missense	possibly damaging	0.53
R6233:Zfp831	UTSW	2	174646697	missense	possibly damaging	0.85
R6248:Zfp831	UTSW	2	174644515	missense	possibly damaging	0.53
R6255:Zfp831	UTSW	2	174646421	missense	possibly damaging	0.96
R6460:Zfp831	UTSW	2	174646567	missense	possibly damaging	0.46
R6477:Zfp831	UTSW	2	174704167	missense	probably benign
R6864:Zfp831	UTSW	2	174646740	missense	possibly damaging	0.72
R7396:Zfp831	UTSW	2	174645209	missense	possibly damaging	0.73
R7447:Zfp831	UTSW	2	174646103	missense	possibly damaging	0.88
R7499:Zfp831	UTSW	2	174644023	missense	possibly damaging	0.73
R7662:Zfp831	UTSW	2	174646141	missense	possibly damaging	0.85
R7857:Zfp831	UTSW	2	174705242	missense	probably benign	0.33
R7889:Zfp831	UTSW	2	174645304	missense	possibly damaging	0.53
R7896:Zfp831	UTSW	2	174647128	missense	possibly damaging	0.53
R8074:Zfp831	UTSW	2	174644735	missense	possibly damaging	0.72
R8089:Zfp831	UTSW	2	174644924	missense	possibly damaging	0.96
R8438:Zfp831	UTSW	2	174645003	missense	possibly damaging	0.53
R8716:Zfp831	UTSW	2	174705256	missense	possibly damaging	0.53
R8757:Zfp831	UTSW	2	174646081	missense	probably benign
R8759:Zfp831	UTSW	2	174646081	missense	probably benign
X0021:Zfp831	UTSW	2	174705869	missense	possibly damaging	0.85
Z1177:Zfp831	UTSW	2	174644188	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACTCCCCAGATAGAAGAGGC -3'
(R):5'- TCACTGCTGGTATCGCTGAG -3'

Sequencing Primer
(F):5'- GGCACACCGGACAGCATTC -3'
(R):5'- TGGTATCGCTGAGCTCCAC -3'

Posted On

2015-06-12