Incidental Mutation 'R4232:Zfp831'
ID320897
Institutional Source Beutler Lab
Gene Symbol Zfp831
Ensembl Gene ENSMUSG00000050600
Gene Namezinc finger protein 831
SynonymsENSMUSG00000050600, OTTMUSG00000017459
MMRRC Submission 041051-MU
Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174643534-174710832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 174705654 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 1543 (W1543C)
Ref Sequence ENSEMBL: ENSMUSP00000060255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059452
AA Change: W1543C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: W1543C

DomainStartEndE-ValueType
low complexity region 120 135 N/A INTRINSIC
ZnF_C2H2 143 165 5.06e-2 SMART
ZnF_C2H2 171 195 7.78e-3 SMART
low complexity region 201 216 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 345 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 1520 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Other mutations in Zfp831
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp831 APN 2 174646285 missense possibly damaging 0.86
IGL00091:Zfp831 APN 2 174645658 missense possibly damaging 0.73
IGL00764:Zfp831 APN 2 174645908 missense possibly damaging 0.72
IGL01538:Zfp831 APN 2 174644606 missense possibly damaging 0.72
IGL01700:Zfp831 APN 2 174644918 missense possibly damaging 0.86
IGL01718:Zfp831 APN 2 174643838 missense possibly damaging 0.86
IGL02221:Zfp831 APN 2 174643726 missense probably benign 0.33
IGL02250:Zfp831 APN 2 174648201 missense possibly damaging 0.53
IGL03209:Zfp831 APN 2 174645266 missense probably benign 0.40
D4043:Zfp831 UTSW 2 174645266 missense probably benign 0.40
FR4304:Zfp831 UTSW 2 174645481 small insertion probably benign
FR4340:Zfp831 UTSW 2 174645480 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645482 small insertion probably benign
FR4589:Zfp831 UTSW 2 174645468 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645476 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645483 small insertion probably benign
IGL02802:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
P0028:Zfp831 UTSW 2 174645346 missense possibly damaging 0.53
PIT4531001:Zfp831 UTSW 2 174646723 missense possibly damaging 0.90
R0631:Zfp831 UTSW 2 174645290 missense possibly damaging 0.53
R0644:Zfp831 UTSW 2 174645863 missense probably benign 0.33
R0782:Zfp831 UTSW 2 174646630 missense probably benign 0.06
R1156:Zfp831 UTSW 2 174646917 missense possibly damaging 0.53
R1280:Zfp831 UTSW 2 174704059 missense probably benign 0.00
R1709:Zfp831 UTSW 2 174645890 missense probably benign 0.33
R1883:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R1884:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R2127:Zfp831 UTSW 2 174648124 missense probably benign 0.33
R2137:Zfp831 UTSW 2 174705746 missense possibly damaging 0.53
R2268:Zfp831 UTSW 2 174644241 missense probably benign 0.01
R2330:Zfp831 UTSW 2 174648089 nonsense probably null
R3547:Zfp831 UTSW 2 174657683 missense probably benign
R3821:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R4163:Zfp831 UTSW 2 174644029 missense possibly damaging 0.53
R4778:Zfp831 UTSW 2 174646807 missense possibly damaging 0.53
R4820:Zfp831 UTSW 2 174705304 missense possibly damaging 0.73
R4912:Zfp831 UTSW 2 174644624 missense probably damaging 1.00
R5119:Zfp831 UTSW 2 174705310 missense probably benign 0.18
R5152:Zfp831 UTSW 2 174644564 missense probably benign 0.33
R5723:Zfp831 UTSW 2 174645407 missense probably benign 0.23
R5741:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
R5888:Zfp831 UTSW 2 174643627 missense probably benign 0.18
R5975:Zfp831 UTSW 2 174644092 missense possibly damaging 0.93
R6092:Zfp831 UTSW 2 174705506 missense probably damaging 0.98
R6158:Zfp831 UTSW 2 174643858 missense possibly damaging 0.53
R6212:Zfp831 UTSW 2 174645868 missense possibly damaging 0.53
R6233:Zfp831 UTSW 2 174646697 missense possibly damaging 0.85
R6248:Zfp831 UTSW 2 174644515 missense possibly damaging 0.53
R6255:Zfp831 UTSW 2 174646421 missense possibly damaging 0.96
R6460:Zfp831 UTSW 2 174646567 missense possibly damaging 0.46
R6477:Zfp831 UTSW 2 174704167 missense probably benign
R6864:Zfp831 UTSW 2 174646740 missense possibly damaging 0.72
R7396:Zfp831 UTSW 2 174645209 missense possibly damaging 0.73
R7447:Zfp831 UTSW 2 174646103 missense possibly damaging 0.88
R7499:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R7662:Zfp831 UTSW 2 174646141 missense possibly damaging 0.85
R7857:Zfp831 UTSW 2 174705242 missense probably benign 0.33
R7889:Zfp831 UTSW 2 174645304 missense possibly damaging 0.53
R7896:Zfp831 UTSW 2 174647128 missense possibly damaging 0.53
R8074:Zfp831 UTSW 2 174644735 missense possibly damaging 0.72
R8089:Zfp831 UTSW 2 174644924 missense possibly damaging 0.96
R8438:Zfp831 UTSW 2 174645003 missense possibly damaging 0.53
R8716:Zfp831 UTSW 2 174705256 missense possibly damaging 0.53
R8757:Zfp831 UTSW 2 174646081 missense probably benign
R8759:Zfp831 UTSW 2 174646081 missense probably benign
X0021:Zfp831 UTSW 2 174705869 missense possibly damaging 0.85
Z1177:Zfp831 UTSW 2 174644188 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTCCCCAGATAGAAGAGGC -3'
(R):5'- TCACTGCTGGTATCGCTGAG -3'

Sequencing Primer
(F):5'- GGCACACCGGACAGCATTC -3'
(R):5'- TGGTATCGCTGAGCTCCAC -3'
Posted On2015-06-12