Incidental Mutation 'R4232:Nfkb1'
ID320900
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonymsp50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
MMRRC Submission 041051-MU
Accession Numbers

Ncbi RefSeq: NM_008689.2; MGI: 97312

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135584655-135691547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135603770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 521 (V521A)
Ref Sequence ENSEMBL: ENSMUSP00000128345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
PDB Structure
STRUCTURE OF NF-KB P50 HOMODIMER BOUND TO A KB SITE [X-RAY DIFFRACTION]
IKAPPABALPHA/NF-KAPPAB COMPLEX [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
STRUCTURE OF THE NUCLEAR FACTOR KAPPA-B (NF-KB) P50 HOMODIMER [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF NF-kB(p50)2 COMPLEXED TO A HIGH-AFFINITY RNA APTAMER [X-RAY DIFFRACTION]
Crystal stucture of WLAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of MLAV mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
Crystal stucture of ILAC mutant of dimerisation domain of NF-kB p50 transcription factor [X-RAY DIFFRACTION]
>> 7 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000029812
AA Change: V521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: V521A

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129428
Predicted Effect unknown
Transcript: ENSMUST00000132668
AA Change: V160A
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163
AA Change: V160A

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000164430
AA Change: V521A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: V521A

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184550
AA Change: V9A
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199588
Meta Mutation Damage Score 0.1389 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Finlay UTSW 3 135595053 nonsense probably null
Frisbee UTSW 3 135613943 missense possibly damaging 0.93
kookaburra UTSW 3 135626611 nonsense probably null
Murgatroyd UTSW 3 135626710 missense possibly damaging 0.72
Poderoso UTSW 3 135613990 missense probably damaging 1.00
Puff UTSW 3 135595053 nonsense probably null
Roomba UTSW 3 135612412 critical splice donor site probably null
Wheelo UTSW 3 135615349 missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
R7175:Nfkb1 UTSW 3 135613990 missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135626659 missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135613697 missense possibly damaging 0.54
R7727:Nfkb1 UTSW 3 135585401 missense possibly damaging 0.48
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGAGGTCTTGTCAGATGAGG -3'
(R):5'- CGAAATGCCCGATTGTGCTTG -3'

Sequencing Primer
(F):5'- CTTGTCAGATGAGGGCAGCTC -3'
(R):5'- GCTTGTTCTAGTCAACACAATCCAG -3'
Posted On2015-06-12