Incidental Mutation 'R4232:Tsc22d4'
ID320904
Institutional Source Beutler Lab
Gene Symbol Tsc22d4
Ensembl Gene ENSMUSG00000029723
Gene NameTSC22 domain family, member 4
Synonyms0610009M14Rik, 1700023B23Rik, Thg-1pit
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score183
Status Validated
Chromosome5
Chromosomal Location137745730-137768450 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 137751370 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100539] [ENSMUST00000100539] [ENSMUST00000100540] [ENSMUST00000100540]
Predicted Effect probably null
Transcript: ENSMUST00000100539
SMART Domains Protein: ENSMUSP00000098107
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:TSC22 318 377 5.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100539
SMART Domains Protein: ENSMUSP00000098107
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:TSC22 318 377 5.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100540
SMART Domains Protein: ENSMUSP00000098108
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:DUF4703 319 509 4.5e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100540
SMART Domains Protein: ENSMUSP00000098108
Gene: ENSMUSG00000029723

DomainStartEndE-ValueType
low complexity region 31 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
Pfam:DUF4703 319 509 4.5e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129399
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSC22D4 is a member of the TSC22 domain family of leucine zipper transcriptional regulators (see TSC22D3; MIM 300506) (Kester et al., 1999 [PubMed 10488076]; Fiorenza et al., 2001 [PubMed 11707329]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Tsc22d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
mastodon UTSW 5 137751370 critical splice donor site probably null
R0103:Tsc22d4 UTSW 5 137747116 start codon destroyed possibly damaging 0.79
R0570:Tsc22d4 UTSW 5 137762419 missense possibly damaging 0.85
R0600:Tsc22d4 UTSW 5 137762655 missense probably damaging 0.97
R0658:Tsc22d4 UTSW 5 137768021 missense probably benign
R2073:Tsc22d4 UTSW 5 137762487 missense possibly damaging 0.45
R3772:Tsc22d4 UTSW 5 137759233 missense possibly damaging 0.86
R4012:Tsc22d4 UTSW 5 137758328 missense probably benign 0.02
R5378:Tsc22d4 UTSW 5 137762464 missense probably damaging 0.99
R5394:Tsc22d4 UTSW 5 137758774 intron probably benign
R5677:Tsc22d4 UTSW 5 137747142 missense probably damaging 1.00
R5765:Tsc22d4 UTSW 5 137758543 missense probably benign 0.04
R6184:Tsc22d4 UTSW 5 137759089 missense probably damaging 0.99
R6263:Tsc22d4 UTSW 5 137768179 missense possibly damaging 0.85
R6700:Tsc22d4 UTSW 5 137758523 missense probably benign 0.04
R6821:Tsc22d4 UTSW 5 137762644 missense possibly damaging 0.92
R6877:Tsc22d4 UTSW 5 137762593 missense possibly damaging 0.85
R7354:Tsc22d4 UTSW 5 137768109 missense probably benign 0.12
R7376:Tsc22d4 UTSW 5 137758152 missense unknown
R7499:Tsc22d4 UTSW 5 137747723 missense probably benign 0.19
R7731:Tsc22d4 UTSW 5 137758694 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGTCTTCACCCTATATGATGGTTC -3'
(R):5'- TCTTGACTGAGCCAAGGAGTC -3'

Sequencing Primer
(F):5'- ACCCTATATGATGGTTCCCACTC -3'
(R):5'- AAGGAGTCCCACCCAGCTTTTTC -3'
Posted On2015-06-12