Mutagenetix > Incidental Mutations

Incidental Mutation 'R4232:Vmn2r58'

320908

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r58

Ensembl Gene

ENSMUSG00000090383

Gene Name

vomeronasal 2, receptor 58

Synonyms

EG628422

MMRRC Submission

041051-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R4232 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41836881-41872670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41837587 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 628 (Y628F)

Ref Sequence

ENSEMBL: ENSMUSP00000126966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171671]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171671
AA Change: Y628F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383
AA Change: Y628F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	471	8e-43	PFAM
Pfam:NCD3G	514	567	1.8e-23	PFAM
Pfam:7tm_3	597	835	2.9e-52	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

92% (58/63)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Aven	A	G	2: 112,627,768	D167G	probably damaging	Het
Celsr2	A	G	3: 108,413,772	F575L	probably benign	Het
Cflar	A	T	1: 58,740,993	Q249L	possibly damaging	Het
Col7a1	G	A	9: 108,972,813		probably null	Het
Dmxl2	T	C	9: 54,419,909	D944G	possibly damaging	Het
Dnah1	T	C	14: 31,304,916	N717S	probably benign	Het
Dnaja3	T	A	16: 4,699,871	N322K	possibly damaging	Het
Dnajb3	A	G	1: 88,205,252	S143P	possibly damaging	Het
Dtx3	A	G	10: 127,193,189	I60T	possibly damaging	Het
Dvl3	A	G	16: 20,524,233		probably benign	Het
Fam71b	C	A	11: 46,407,405	T512K	possibly damaging	Het
Fkbp7	A	T	2: 76,663,317	D177E	possibly damaging	Het
Galnt7	T	C	8: 57,652,966	I5V	probably benign	Het
Helz2	A	T	2: 181,229,902	L2639Q	probably damaging	Het
Hnrnpr	T	C	4: 136,339,189	M394T	probably benign	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kif14	T	A	1: 136,516,363	C1364*	probably null	Het
Macf1	T	C	4: 123,432,392	E5104G	probably damaging	Het
Mkl1	T	A	15: 81,023,595	K29M	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Mtbp	CATGA	CATGAATGA	15: 55,620,677		probably null	Het
Nfkb1	A	G	3: 135,603,770	V521A	probably damaging	Het
Olfr1535	T	C	13: 21,555,461	D187G	probably damaging	Het
Olfr850	G	T	9: 19,477,726	L175M	probably damaging	Het
P2rx6	T	C	16: 17,570,767	L335P	probably damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Pgpep1l	T	C	7: 68,237,079	T161A	probably benign	Het
Prss40	A	G	1: 34,560,792	V38A	probably benign	Het
Ptk2	C	A	15: 73,309,849	R104L	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Rtp4	A	G	16: 23,613,083	N122D	possibly damaging	Het
Samd8	A	G	14: 21,780,145	Y213C	probably benign	Het
Shcbp1	T	A	8: 4,736,372	T577S	probably benign	Het
Tiprl	A	G	1: 165,222,587	V153A	probably damaging	Het
Tmprss7	A	T	16: 45,656,573	D775E	probably damaging	Het
Tnr	T	C	1: 159,886,215	S738P	possibly damaging	Het
Tsc22d4	T	C	5: 137,751,370		probably null	Het
Ttc21a	A	T	9: 119,942,618	H161L	probably benign	Het
Ubqln3	T	A	7: 104,141,803	E360V	probably benign	Het
Ugt1a10	C	A	1: 88,056,210	D243E	probably benign	Het
Vmn2r19	G	A	6: 123,329,912	V460I	probably benign	Het
Wnk1	A	T	6: 119,949,261	S1588T	possibly damaging	Het
Wscd2	A	G	5: 113,560,984	D200G	probably benign	Het
Zfp831	G	C	2: 174,705,654	W1543C	possibly damaging	Het

Other mutations in Vmn2r58

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Vmn2r58	APN	7	41864430	missense	possibly damaging	0.53
IGL00924:Vmn2r58	APN	7	41837467	missense	probably damaging	1.00
IGL01291:Vmn2r58	APN	7	41864511	missense	probably benign	0.02
IGL01480:Vmn2r58	APN	7	41864692	missense	probably benign	0.01
IGL01551:Vmn2r58	APN	7	41865279	missense	probably damaging	0.97
IGL01591:Vmn2r58	APN	7	41865329	missense	probably benign	0.03
IGL01940:Vmn2r58	APN	7	41837647	missense	probably benign	0.00
IGL01994:Vmn2r58	APN	7	41836970	missense	probably damaging	0.98
IGL02041:Vmn2r58	APN	7	41865279	missense	probably damaging	0.97
IGL02222:Vmn2r58	APN	7	41864025	missense	possibly damaging	0.81
IGL02317:Vmn2r58	APN	7	41837341	missense	possibly damaging	0.89
IGL02614:Vmn2r58	APN	7	41837129	missense	probably damaging	1.00
IGL02673:Vmn2r58	APN	7	41864658	missense	possibly damaging	0.90
IGL03323:Vmn2r58	APN	7	41861871	missense	probably benign	0.06
IGL03337:Vmn2r58	APN	7	41864386	missense	possibly damaging	0.93
IGL03380:Vmn2r58	APN	7	41864450	missense	probably benign	0.00
ANU05:Vmn2r58	UTSW	7	41864511	missense	probably benign	0.02
R0138:Vmn2r58	UTSW	7	41837624	missense	probably damaging	1.00
R0141:Vmn2r58	UTSW	7	41861885	missense	probably benign	0.11
R0421:Vmn2r58	UTSW	7	41865204	missense	probably benign	0.02
R0604:Vmn2r58	UTSW	7	41860576	missense	possibly damaging	0.78
R0854:Vmn2r58	UTSW	7	41837138	missense	probably damaging	1.00
R1413:Vmn2r58	UTSW	7	41863963	missense	probably benign	0.01
R1441:Vmn2r58	UTSW	7	41837440	missense	probably damaging	1.00
R1678:Vmn2r58	UTSW	7	41864056	missense	probably benign	0.40
R1691:Vmn2r58	UTSW	7	41837489	missense	possibly damaging	0.95
R1699:Vmn2r58	UTSW	7	41860527	missense	probably benign
R1865:Vmn2r58	UTSW	7	41837258	missense	possibly damaging	0.95
R2008:Vmn2r58	UTSW	7	41860500	missense	probably damaging	1.00
R2036:Vmn2r58	UTSW	7	41863993	missense	probably benign
R2202:Vmn2r58	UTSW	7	41864170	missense	probably benign	0.07
R3787:Vmn2r58	UTSW	7	41864074	missense	probably benign	0.01
R3883:Vmn2r58	UTSW	7	41864490	nonsense	probably null
R3944:Vmn2r58	UTSW	7	41864461	missense	probably benign	0.03
R3949:Vmn2r58	UTSW	7	41863924	missense	probably benign	0.08
R4409:Vmn2r58	UTSW	7	41872627	missense	possibly damaging	0.69
R4411:Vmn2r58	UTSW	7	41861936	missense	possibly damaging	0.85
R4413:Vmn2r58	UTSW	7	41861936	missense	possibly damaging	0.85
R4600:Vmn2r58	UTSW	7	41872622	missense	probably benign	0.03
R4610:Vmn2r58	UTSW	7	41837693	missense	probably benign
R4646:Vmn2r58	UTSW	7	41860511	missense	probably damaging	0.96
R4793:Vmn2r58	UTSW	7	41865071	missense	probably damaging	0.99
R4870:Vmn2r58	UTSW	7	41837215	missense	possibly damaging	0.76
R4981:Vmn2r58	UTSW	7	41837461	missense	probably damaging	1.00
R4993:Vmn2r58	UTSW	7	41837752	missense	probably benign	0.00
R5024:Vmn2r58	UTSW	7	41864322	missense	probably damaging	0.99
R5064:Vmn2r58	UTSW	7	41837110	missense	probably damaging	0.99
R5330:Vmn2r58	UTSW	7	41863960	nonsense	probably null
R5526:Vmn2r58	UTSW	7	41872645	missense	probably benign	0.01
R5980:Vmn2r58	UTSW	7	41865056	missense	possibly damaging	0.81
R6163:Vmn2r58	UTSW	7	41837401	missense	probably benign	0.31
R6365:Vmn2r58	UTSW	7	41864183	missense	probably benign	0.42
R6567:Vmn2r58	UTSW	7	41865249	missense	probably benign	0.34
R6594:Vmn2r58	UTSW	7	41837111	missense	possibly damaging	0.69
R6980:Vmn2r58	UTSW	7	41864238	missense	possibly damaging	0.64
R7373:Vmn2r58	UTSW	7	41837788	missense	probably damaging	1.00
R7458:Vmn2r58	UTSW	7	41837699	missense	probably benign	0.06
R7630:Vmn2r58	UTSW	7	41864187	missense	probably damaging	0.99
R7807:Vmn2r58	UTSW	7	41872486	missense	probably benign	0.05
RF006:Vmn2r58	UTSW	7	41836959	frame shift	probably null
RF027:Vmn2r58	UTSW	7	41836959	frame shift	probably null
Z1176:Vmn2r58	UTSW	7	41864365	missense	not run

Predicted Primers

PCR Primer
(F):5'- CATTCTAGCTGGAACTGTGGCC -3'
(R):5'- GTGCATGAAGTGTCCAGAAAGTC -3'

Sequencing Primer
(F):5'- CTGTGGCCTTGAATGCAATAAC -3'
(R):5'- AGTGTCCAGAAAGTCACTATGC -3'

Posted On

2015-06-12