Incidental Mutation 'R4232:Vmn2r58'
ID320908
Institutional Source Beutler Lab
Gene Symbol Vmn2r58
Ensembl Gene ENSMUSG00000090383
Gene Namevomeronasal 2, receptor 58
SynonymsEG628422
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41836881-41872670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41837587 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 628 (Y628F)
Ref Sequence ENSEMBL: ENSMUSP00000126966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171671
AA Change: Y628F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126966
Gene: ENSMUSG00000090383
AA Change: Y628F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 8e-43 PFAM
Pfam:NCD3G 514 567 1.8e-23 PFAM
Pfam:7tm_3 597 835 2.9e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Vmn2r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn2r58 APN 7 41864430 missense possibly damaging 0.53
IGL00924:Vmn2r58 APN 7 41837467 missense probably damaging 1.00
IGL01291:Vmn2r58 APN 7 41864511 missense probably benign 0.02
IGL01480:Vmn2r58 APN 7 41864692 missense probably benign 0.01
IGL01551:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL01591:Vmn2r58 APN 7 41865329 missense probably benign 0.03
IGL01940:Vmn2r58 APN 7 41837647 missense probably benign 0.00
IGL01994:Vmn2r58 APN 7 41836970 missense probably damaging 0.98
IGL02041:Vmn2r58 APN 7 41865279 missense probably damaging 0.97
IGL02222:Vmn2r58 APN 7 41864025 missense possibly damaging 0.81
IGL02317:Vmn2r58 APN 7 41837341 missense possibly damaging 0.89
IGL02614:Vmn2r58 APN 7 41837129 missense probably damaging 1.00
IGL02673:Vmn2r58 APN 7 41864658 missense possibly damaging 0.90
IGL03323:Vmn2r58 APN 7 41861871 missense probably benign 0.06
IGL03337:Vmn2r58 APN 7 41864386 missense possibly damaging 0.93
IGL03380:Vmn2r58 APN 7 41864450 missense probably benign 0.00
ANU05:Vmn2r58 UTSW 7 41864511 missense probably benign 0.02
R0138:Vmn2r58 UTSW 7 41837624 missense probably damaging 1.00
R0141:Vmn2r58 UTSW 7 41861885 missense probably benign 0.11
R0421:Vmn2r58 UTSW 7 41865204 missense probably benign 0.02
R0604:Vmn2r58 UTSW 7 41860576 missense possibly damaging 0.78
R0854:Vmn2r58 UTSW 7 41837138 missense probably damaging 1.00
R1413:Vmn2r58 UTSW 7 41863963 missense probably benign 0.01
R1441:Vmn2r58 UTSW 7 41837440 missense probably damaging 1.00
R1678:Vmn2r58 UTSW 7 41864056 missense probably benign 0.40
R1691:Vmn2r58 UTSW 7 41837489 missense possibly damaging 0.95
R1699:Vmn2r58 UTSW 7 41860527 missense probably benign
R1865:Vmn2r58 UTSW 7 41837258 missense possibly damaging 0.95
R2008:Vmn2r58 UTSW 7 41860500 missense probably damaging 1.00
R2036:Vmn2r58 UTSW 7 41863993 missense probably benign
R2202:Vmn2r58 UTSW 7 41864170 missense probably benign 0.07
R3787:Vmn2r58 UTSW 7 41864074 missense probably benign 0.01
R3883:Vmn2r58 UTSW 7 41864490 nonsense probably null
R3944:Vmn2r58 UTSW 7 41864461 missense probably benign 0.03
R3949:Vmn2r58 UTSW 7 41863924 missense probably benign 0.08
R4409:Vmn2r58 UTSW 7 41872627 missense possibly damaging 0.69
R4411:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4413:Vmn2r58 UTSW 7 41861936 missense possibly damaging 0.85
R4600:Vmn2r58 UTSW 7 41872622 missense probably benign 0.03
R4610:Vmn2r58 UTSW 7 41837693 missense probably benign
R4646:Vmn2r58 UTSW 7 41860511 missense probably damaging 0.96
R4793:Vmn2r58 UTSW 7 41865071 missense probably damaging 0.99
R4870:Vmn2r58 UTSW 7 41837215 missense possibly damaging 0.76
R4981:Vmn2r58 UTSW 7 41837461 missense probably damaging 1.00
R4993:Vmn2r58 UTSW 7 41837752 missense probably benign 0.00
R5024:Vmn2r58 UTSW 7 41864322 missense probably damaging 0.99
R5064:Vmn2r58 UTSW 7 41837110 missense probably damaging 0.99
R5330:Vmn2r58 UTSW 7 41863960 nonsense probably null
R5526:Vmn2r58 UTSW 7 41872645 missense probably benign 0.01
R5980:Vmn2r58 UTSW 7 41865056 missense possibly damaging 0.81
R6163:Vmn2r58 UTSW 7 41837401 missense probably benign 0.31
R6365:Vmn2r58 UTSW 7 41864183 missense probably benign 0.42
R6567:Vmn2r58 UTSW 7 41865249 missense probably benign 0.34
R6594:Vmn2r58 UTSW 7 41837111 missense possibly damaging 0.69
R6980:Vmn2r58 UTSW 7 41864238 missense possibly damaging 0.64
R7373:Vmn2r58 UTSW 7 41837788 missense probably damaging 1.00
R7458:Vmn2r58 UTSW 7 41837699 missense probably benign 0.06
R7630:Vmn2r58 UTSW 7 41864187 missense probably damaging 0.99
R7807:Vmn2r58 UTSW 7 41872486 missense probably benign 0.05
RF006:Vmn2r58 UTSW 7 41836959 frame shift probably null
RF027:Vmn2r58 UTSW 7 41836959 frame shift probably null
Z1176:Vmn2r58 UTSW 7 41864365 missense not run
Predicted Primers PCR Primer
(F):5'- CATTCTAGCTGGAACTGTGGCC -3'
(R):5'- GTGCATGAAGTGTCCAGAAAGTC -3'

Sequencing Primer
(F):5'- CTGTGGCCTTGAATGCAATAAC -3'
(R):5'- AGTGTCCAGAAAGTCACTATGC -3'
Posted On2015-06-12