Incidental Mutation 'R0396:Myom1'
ID 32091
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 71326455-71433851 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71341688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 149 (V149E)
Ref Sequence ENSEMBL: ENSMUSP00000136266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: V149E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: V149E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: V149E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.7248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
D630045J12Rik T C 6: 38,173,671 (GRCm39) S166G possibly damaging Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Nedd4l T A 18: 65,294,725 (GRCm39) probably benign Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sdk2 T C 11: 113,720,793 (GRCm39) I1379V probably benign Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,695,499 (GRCm39) probably null Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Vmn2r28 T A 7: 5,491,513 (GRCm39) I245L probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,433,093 (GRCm39) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,391,424 (GRCm39) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,406,944 (GRCm39) splice site probably benign
IGL00928:Myom1 APN 17 71,396,908 (GRCm39) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,384,912 (GRCm39) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,408,215 (GRCm39) splice site probably benign
IGL01588:Myom1 APN 17 71,424,432 (GRCm39) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,433,173 (GRCm39) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,406,988 (GRCm39) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,351,471 (GRCm39) splice site probably benign
IGL01766:Myom1 APN 17 71,384,283 (GRCm39) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,354,711 (GRCm39) splice site probably benign
IGL02122:Myom1 APN 17 71,399,132 (GRCm39) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,379,132 (GRCm39) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,415,310 (GRCm39) nonsense probably null
IGL02486:Myom1 APN 17 71,406,939 (GRCm39) splice site probably benign
IGL02501:Myom1 APN 17 71,379,076 (GRCm39) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,408,093 (GRCm39) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,391,344 (GRCm39) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,413,349 (GRCm39) splice site probably benign
IGL02945:Myom1 APN 17 71,399,088 (GRCm39) splice site probably benign
IGL03086:Myom1 APN 17 71,415,666 (GRCm39) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,391,311 (GRCm39) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,384,360 (GRCm39) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,352,750 (GRCm39) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,354,782 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,344,292 (GRCm39) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,352,744 (GRCm39) missense possibly damaging 0.72
R0496:Myom1 UTSW 17 71,391,301 (GRCm39) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,399,215 (GRCm39) splice site probably benign
R0511:Myom1 UTSW 17 71,391,312 (GRCm39) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,427,643 (GRCm39) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,374,308 (GRCm39) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,428,131 (GRCm39) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,384,762 (GRCm39) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,359,714 (GRCm39) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,408,024 (GRCm39) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,371,592 (GRCm39) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,330,189 (GRCm39) missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71,341,574 (GRCm39) missense probably damaging 0.98
R2442:Myom1 UTSW 17 71,417,730 (GRCm39) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,384,807 (GRCm39) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,341,648 (GRCm39) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,408,215 (GRCm39) splice site probably benign
R3440:Myom1 UTSW 17 71,352,658 (GRCm39) splice site probably null
R3842:Myom1 UTSW 17 71,352,619 (GRCm39) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,399,135 (GRCm39) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,343,348 (GRCm39) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,407,069 (GRCm39) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,379,114 (GRCm39) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,384,405 (GRCm39) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,406,967 (GRCm39) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,416,782 (GRCm39) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,417,717 (GRCm39) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,424,438 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,417,746 (GRCm39) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,415,690 (GRCm39) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,433,132 (GRCm39) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,329,887 (GRCm39) nonsense probably null
R6313:Myom1 UTSW 17 71,389,483 (GRCm39) missense probably benign
R6369:Myom1 UTSW 17 71,408,071 (GRCm39) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,389,300 (GRCm39) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,407,393 (GRCm39) splice site probably null
R6933:Myom1 UTSW 17 71,359,666 (GRCm39) missense probably damaging 1.00
R7168:Myom1 UTSW 17 71,396,942 (GRCm39) missense probably benign 0.00
R7286:Myom1 UTSW 17 71,352,544 (GRCm39) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,387,892 (GRCm39) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,391,235 (GRCm39) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,424,431 (GRCm39) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,352,747 (GRCm39) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,407,057 (GRCm39) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,391,290 (GRCm39) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,343,448 (GRCm39) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,413,199 (GRCm39) missense probably damaging 1.00
R8981:Myom1 UTSW 17 71,391,316 (GRCm39) missense probably benign 0.09
R9012:Myom1 UTSW 17 71,407,103 (GRCm39) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,343,295 (GRCm39) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,408,051 (GRCm39) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,374,325 (GRCm39) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,384,888 (GRCm39) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,343,288 (GRCm39) missense probably benign 0.00
R9440:Myom1 UTSW 17 71,433,329 (GRCm39) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,368,122 (GRCm39) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,394,476 (GRCm39) missense probably damaging 1.00
R9612:Myom1 UTSW 17 71,412,475 (GRCm39) nonsense probably null
R9645:Myom1 UTSW 17 71,399,204 (GRCm39) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,407,066 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCACATCATATTACCGCAGACTGCC -3'
(R):5'- GCAATGCCTTGATTTCACTTAGCCC -3'

Sequencing Primer
(F):5'- CCCAAGGTTCTGGGGAAATTC -3'
(R):5'- CATCTTCCTCAGTGTGGGC -3'
Posted On 2013-04-24