Incidental Mutation 'R0396:Myom1'
ID32091
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0396 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71034693 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 149 (V149E)
Ref Sequence ENSEMBL: ENSMUSP00000136266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: V149E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073211
AA Change: V149E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179759
AA Change: V149E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: V149E

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.7248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCACATCATATTACCGCAGACTGCC -3'
(R):5'- GCAATGCCTTGATTTCACTTAGCCC -3'

Sequencing Primer
(F):5'- CCCAAGGTTCTGGGGAAATTC -3'
(R):5'- CATCTTCCTCAGTGTGGGC -3'
Posted On2013-04-24