Incidental Mutation 'R4232:Ubqln3'
ID 320910
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 041051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R4232 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103791010 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 360 (E360V)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: E360V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: E360V

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Ajuba T C 14: 54,806,983 (GRCm39) R490G probably damaging Het
Akap6 T A 12: 53,186,454 (GRCm39) N1289K probably damaging Het
Arhgap21 A G 2: 20,891,948 (GRCm39) V161A probably damaging Het
Atg14 T C 14: 47,788,802 (GRCm39) K184E probably benign Het
Aven A G 2: 112,458,113 (GRCm39) D167G probably damaging Het
Celsr2 A G 3: 108,321,088 (GRCm39) F575L probably benign Het
Cflar A T 1: 58,780,152 (GRCm39) Q249L possibly damaging Het
Col7a1 G A 9: 108,801,881 (GRCm39) probably null Het
Dmxl2 T C 9: 54,327,193 (GRCm39) D944G possibly damaging Het
Dnah1 T C 14: 31,026,873 (GRCm39) N717S probably benign Het
Dnaja3 T A 16: 4,517,735 (GRCm39) N322K possibly damaging Het
Dnajb3 A G 1: 88,132,974 (GRCm39) S143P possibly damaging Het
Dtx3 A G 10: 127,029,058 (GRCm39) I60T possibly damaging Het
Dvl3 A G 16: 20,342,983 (GRCm39) probably benign Het
Fkbp7 A T 2: 76,493,661 (GRCm39) D177E possibly damaging Het
Galnt7 T C 8: 58,106,000 (GRCm39) I5V probably benign Het
Garin3 C A 11: 46,298,232 (GRCm39) T512K possibly damaging Het
Helz2 A T 2: 180,871,695 (GRCm39) L2639Q probably damaging Het
Hnrnpr T C 4: 136,066,500 (GRCm39) M394T probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kif14 T A 1: 136,444,101 (GRCm39) C1364* probably null Het
Macf1 T C 4: 123,326,185 (GRCm39) E5104G probably damaging Het
Mrps30 T C 13: 118,523,376 (GRCm39) D132G probably damaging Het
Mrtfa T A 15: 80,907,796 (GRCm39) K29M probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,484,073 (GRCm39) probably null Het
Nfkb1 A G 3: 135,309,531 (GRCm39) V521A probably damaging Het
Or2b7 T C 13: 21,739,631 (GRCm39) D187G probably damaging Het
Or7g32 G T 9: 19,389,022 (GRCm39) L175M probably damaging Het
P2rx6 T C 16: 17,388,631 (GRCm39) L335P probably damaging Het
Pcdhga5 A G 18: 37,829,001 (GRCm39) D483G possibly damaging Het
Pgpep1l T C 7: 67,886,827 (GRCm39) T161A probably benign Het
Prss40 A G 1: 34,599,873 (GRCm39) V38A probably benign Het
Ptk2 C A 15: 73,181,698 (GRCm39) R104L possibly damaging Het
Ralgapa1 C T 12: 55,687,429 (GRCm39) R2019Q probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rtp4 A G 16: 23,431,833 (GRCm39) N122D possibly damaging Het
Samd8 A G 14: 21,830,213 (GRCm39) Y213C probably benign Het
Shcbp1 T A 8: 4,786,372 (GRCm39) T577S probably benign Het
Tiprl A G 1: 165,050,156 (GRCm39) V153A probably damaging Het
Tmprss7 A T 16: 45,476,936 (GRCm39) D775E probably damaging Het
Tnr T C 1: 159,713,785 (GRCm39) S738P possibly damaging Het
Tsc22d4 T C 5: 137,749,632 (GRCm39) probably null Het
Ttc21a A T 9: 119,771,684 (GRCm39) H161L probably benign Het
Ugt1a10 C A 1: 87,983,932 (GRCm39) D243E probably benign Het
Vmn2r19 G A 6: 123,306,871 (GRCm39) V460I probably benign Het
Vmn2r58 T A 7: 41,487,011 (GRCm39) Y628F possibly damaging Het
Wnk1 A T 6: 119,926,222 (GRCm39) S1588T possibly damaging Het
Wscd2 A G 5: 113,699,045 (GRCm39) D200G probably benign Het
Zfp831 G C 2: 174,547,447 (GRCm39) W1543C possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGTAGGCTTCCACCTTGTC -3'
(R):5'- AATTGTGACCCTCTGCCCAAC -3'

Sequencing Primer
(F):5'- GTAGGCTTCCACCTTGTCCAGTAC -3'
(R):5'- ACCCCTGGACTTCCACATATG -3'
Posted On 2015-06-12