Incidental Mutation 'R4232:Shcbp1'
ID 320911
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene Name Shc SH2-domain binding protein 1
Synonyms mPAL
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4232 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4735976-4779567 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4736372 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 577 (T577S)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
AlphaFold Q9Z179
Predicted Effect probably benign
Transcript: ENSMUST00000022945
AA Change: T577S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: T577S

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect probably benign
Transcript: ENSMUST00000207876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 splice site probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
R7943:Shcbp1 UTSW 8 4748812 missense possibly damaging 0.78
R8114:Shcbp1 UTSW 8 4767930 missense probably damaging 1.00
R8386:Shcbp1 UTSW 8 4767951 missense probably damaging 1.00
R8435:Shcbp1 UTSW 8 4748734 missense probably benign 0.04
R9234:Shcbp1 UTSW 8 4748800 missense possibly damaging 0.77
R9313:Shcbp1 UTSW 8 4744518 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense possibly damaging 0.59
Z1177:Shcbp1 UTSW 8 4736146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGTGTAATCCCAAGTTCAC -3'
(R):5'- CCAGTGACTGAGATTTTAGGATGAAG -3'

Sequencing Primer
(F):5'- GTGTAATCCCAAGTTCACTCAGTC -3'
(R):5'- TGCAAGAAGATCTAAGTAGCTACTC -3'
Posted On 2015-06-12