Incidental Mutation 'R4232:Olfr850'
ID320913
Institutional Source Beutler Lab
Gene Symbol Olfr850
Ensembl Gene ENSMUSG00000094535
Gene Nameolfactory receptor 850
SynonymsGA_x6K02T2PVTD-13214162-13213224, MOR147-2
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19477301-19478248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19477726 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 175 (L175M)
Ref Sequence ENSEMBL: ENSMUSP00000076569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077347] [ENSMUST00000211832]
Predicted Effect probably damaging
Transcript: ENSMUST00000077347
AA Change: L175M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076569
Gene: ENSMUSG00000094535
AA Change: L175M

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 304 1e-6 PFAM
Pfam:7tm_1 44 293 5.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211832
AA Change: L172M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Olfr850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02723:Olfr850 APN 9 19477509 missense probably damaging 1.00
IGL03294:Olfr850 APN 9 19477989 missense possibly damaging 0.95
PIT4305001:Olfr850 UTSW 9 19478061 missense probably damaging 1.00
R0364:Olfr850 UTSW 9 19477972 nonsense probably null
R0379:Olfr850 UTSW 9 19477480 missense possibly damaging 0.75
R0449:Olfr850 UTSW 9 19478092 missense possibly damaging 0.89
R0682:Olfr850 UTSW 9 19477349 missense probably benign 0.03
R0693:Olfr850 UTSW 9 19477972 nonsense probably null
R1484:Olfr850 UTSW 9 19478127 missense probably damaging 1.00
R1599:Olfr850 UTSW 9 19478221 missense probably damaging 0.97
R1626:Olfr850 UTSW 9 19478199 missense probably damaging 1.00
R1742:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R4237:Olfr850 UTSW 9 19477597 missense probably benign 0.00
R5116:Olfr850 UTSW 9 19477798 missense possibly damaging 0.67
R5643:Olfr850 UTSW 9 19477557 missense probably benign 0.22
R6271:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R6815:Olfr850 UTSW 9 19477765 missense probably benign 0.20
R7222:Olfr850 UTSW 9 19477467 missense probably damaging 1.00
R7592:Olfr850 UTSW 9 19477832 missense possibly damaging 0.52
RF034:Olfr850 UTSW 9 19477632 missense possibly damaging 0.46
X0058:Olfr850 UTSW 9 19478223 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCACAGGTGGTAAAGGCTTTG -3'
(R):5'- TGGCATGGAAAACTGTCTCC -3'

Sequencing Primer
(F):5'- AAAGGCTTTGTGCTTTCCTTCTAATG -3'
(R):5'- GCATGGAAAACTGTCTCCTTGCAG -3'
Posted On2015-06-12