Incidental Mutation 'R4232:Ttc21a'
ID 320917
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Name tetratricopeptide repeat domain 21A
Synonyms Thm2, 4921538N17Rik
MMRRC Submission 041051-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.168) question?
Stock # R4232 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119766672-119796859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119771684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 161 (H161L)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
AlphaFold Q8C0S4
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: H161L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: H161L

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Ajuba T C 14: 54,806,983 (GRCm39) R490G probably damaging Het
Akap6 T A 12: 53,186,454 (GRCm39) N1289K probably damaging Het
Arhgap21 A G 2: 20,891,948 (GRCm39) V161A probably damaging Het
Atg14 T C 14: 47,788,802 (GRCm39) K184E probably benign Het
Aven A G 2: 112,458,113 (GRCm39) D167G probably damaging Het
Celsr2 A G 3: 108,321,088 (GRCm39) F575L probably benign Het
Cflar A T 1: 58,780,152 (GRCm39) Q249L possibly damaging Het
Col7a1 G A 9: 108,801,881 (GRCm39) probably null Het
Dmxl2 T C 9: 54,327,193 (GRCm39) D944G possibly damaging Het
Dnah1 T C 14: 31,026,873 (GRCm39) N717S probably benign Het
Dnaja3 T A 16: 4,517,735 (GRCm39) N322K possibly damaging Het
Dnajb3 A G 1: 88,132,974 (GRCm39) S143P possibly damaging Het
Dtx3 A G 10: 127,029,058 (GRCm39) I60T possibly damaging Het
Dvl3 A G 16: 20,342,983 (GRCm39) probably benign Het
Fkbp7 A T 2: 76,493,661 (GRCm39) D177E possibly damaging Het
Galnt7 T C 8: 58,106,000 (GRCm39) I5V probably benign Het
Garin3 C A 11: 46,298,232 (GRCm39) T512K possibly damaging Het
Helz2 A T 2: 180,871,695 (GRCm39) L2639Q probably damaging Het
Hnrnpr T C 4: 136,066,500 (GRCm39) M394T probably benign Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kif14 T A 1: 136,444,101 (GRCm39) C1364* probably null Het
Macf1 T C 4: 123,326,185 (GRCm39) E5104G probably damaging Het
Mrps30 T C 13: 118,523,376 (GRCm39) D132G probably damaging Het
Mrtfa T A 15: 80,907,796 (GRCm39) K29M probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,484,073 (GRCm39) probably null Het
Nfkb1 A G 3: 135,309,531 (GRCm39) V521A probably damaging Het
Or2b7 T C 13: 21,739,631 (GRCm39) D187G probably damaging Het
Or7g32 G T 9: 19,389,022 (GRCm39) L175M probably damaging Het
P2rx6 T C 16: 17,388,631 (GRCm39) L335P probably damaging Het
Pcdhga5 A G 18: 37,829,001 (GRCm39) D483G possibly damaging Het
Pgpep1l T C 7: 67,886,827 (GRCm39) T161A probably benign Het
Prss40 A G 1: 34,599,873 (GRCm39) V38A probably benign Het
Ptk2 C A 15: 73,181,698 (GRCm39) R104L possibly damaging Het
Ralgapa1 C T 12: 55,687,429 (GRCm39) R2019Q probably damaging Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
Rtp4 A G 16: 23,431,833 (GRCm39) N122D possibly damaging Het
Samd8 A G 14: 21,830,213 (GRCm39) Y213C probably benign Het
Shcbp1 T A 8: 4,786,372 (GRCm39) T577S probably benign Het
Tiprl A G 1: 165,050,156 (GRCm39) V153A probably damaging Het
Tmprss7 A T 16: 45,476,936 (GRCm39) D775E probably damaging Het
Tnr T C 1: 159,713,785 (GRCm39) S738P possibly damaging Het
Tsc22d4 T C 5: 137,749,632 (GRCm39) probably null Het
Ubqln3 T A 7: 103,791,010 (GRCm39) E360V probably benign Het
Ugt1a10 C A 1: 87,983,932 (GRCm39) D243E probably benign Het
Vmn2r19 G A 6: 123,306,871 (GRCm39) V460I probably benign Het
Vmn2r58 T A 7: 41,487,011 (GRCm39) Y628F possibly damaging Het
Wnk1 A T 6: 119,926,222 (GRCm39) S1588T possibly damaging Het
Wscd2 A G 5: 113,699,045 (GRCm39) D200G probably benign Het
Zfp831 G C 2: 174,547,447 (GRCm39) W1543C possibly damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119,794,885 (GRCm39) missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119,787,182 (GRCm39) missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119,785,989 (GRCm39) missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119,779,901 (GRCm39) nonsense probably null
IGL02252:Ttc21a APN 9 119,785,994 (GRCm39) missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119,787,347 (GRCm39) missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119,771,642 (GRCm39) missense probably benign 0.01
IGL03155:Ttc21a APN 9 119,773,042 (GRCm39) critical splice donor site probably null
IGL03323:Ttc21a APN 9 119,769,602 (GRCm39) intron probably benign
R0054:Ttc21a UTSW 9 119,773,006 (GRCm39) missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119,783,628 (GRCm39) missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119,768,220 (GRCm39) intron probably benign
R0541:Ttc21a UTSW 9 119,785,892 (GRCm39) intron probably benign
R0545:Ttc21a UTSW 9 119,787,865 (GRCm39) missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119,790,908 (GRCm39) missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119,783,718 (GRCm39) missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119,783,327 (GRCm39) missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119,771,707 (GRCm39) missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119,786,013 (GRCm39) missense probably benign 0.00
R1631:Ttc21a UTSW 9 119,783,228 (GRCm39) splice site probably null
R1905:Ttc21a UTSW 9 119,795,823 (GRCm39) missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119,793,361 (GRCm39) missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119,769,527 (GRCm39) missense probably benign 0.01
R2265:Ttc21a UTSW 9 119,788,074 (GRCm39) missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119,795,189 (GRCm39) missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119,770,331 (GRCm39) missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119,781,320 (GRCm39) missense probably benign 0.02
R3792:Ttc21a UTSW 9 119,783,231 (GRCm39) missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119,779,882 (GRCm39) intron probably benign
R4492:Ttc21a UTSW 9 119,770,346 (GRCm39) missense probably benign 0.00
R4498:Ttc21a UTSW 9 119,787,885 (GRCm39) missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119,790,828 (GRCm39) missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119,788,103 (GRCm39) missense probably benign
R4960:Ttc21a UTSW 9 119,774,067 (GRCm39) missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119,774,027 (GRCm39) missense probably benign 0.00
R5015:Ttc21a UTSW 9 119,795,195 (GRCm39) missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119,771,731 (GRCm39) missense probably benign 0.01
R5117:Ttc21a UTSW 9 119,795,631 (GRCm39) missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119,781,278 (GRCm39) missense probably benign 0.04
R5452:Ttc21a UTSW 9 119,780,037 (GRCm39) missense probably benign 0.00
R5733:Ttc21a UTSW 9 119,770,327 (GRCm39) missense probably benign
R5734:Ttc21a UTSW 9 119,795,732 (GRCm39) missense probably benign
R5869:Ttc21a UTSW 9 119,787,858 (GRCm39) missense probably benign 0.03
R6214:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119,773,028 (GRCm39) missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119,770,268 (GRCm39) missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119,771,701 (GRCm39) missense probably benign 0.24
R7009:Ttc21a UTSW 9 119,787,139 (GRCm39) nonsense probably null
R7060:Ttc21a UTSW 9 119,795,742 (GRCm39) missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119,774,607 (GRCm39) missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119,788,117 (GRCm39) missense probably benign 0.01
R7438:Ttc21a UTSW 9 119,774,605 (GRCm39) missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119,787,135 (GRCm39) missense probably benign 0.12
R7703:Ttc21a UTSW 9 119,788,095 (GRCm39) missense probably benign 0.14
R8076:Ttc21a UTSW 9 119,795,392 (GRCm39) missense probably benign 0.01
R8217:Ttc21a UTSW 9 119,783,694 (GRCm39) missense probably benign 0.00
R8471:Ttc21a UTSW 9 119,792,242 (GRCm39) splice site probably null
R8558:Ttc21a UTSW 9 119,787,835 (GRCm39) missense probably damaging 0.97
R8696:Ttc21a UTSW 9 119,772,977 (GRCm39) missense possibly damaging 0.80
R8739:Ttc21a UTSW 9 119,796,371 (GRCm39) missense probably benign 0.00
R8768:Ttc21a UTSW 9 119,770,286 (GRCm39) missense probably damaging 1.00
R8912:Ttc21a UTSW 9 119,770,367 (GRCm39) critical splice donor site probably null
R9006:Ttc21a UTSW 9 119,792,130 (GRCm39) intron probably benign
R9214:Ttc21a UTSW 9 119,772,941 (GRCm39) missense probably benign 0.17
R9235:Ttc21a UTSW 9 119,774,559 (GRCm39) missense probably benign 0.03
R9521:Ttc21a UTSW 9 119,787,181 (GRCm39) missense probably damaging 0.98
R9643:Ttc21a UTSW 9 119,771,686 (GRCm39) missense probably benign
RF004:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119,771,746 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGATCTGGAAAGTAAGAGGTGTC -3'
(R):5'- ACACACCCAGAAGGATGGTC -3'

Sequencing Primer
(F):5'- ACACCACCTGGCAGAGGAG -3'
(R):5'- CTGGATCTCAGATCTGGCCTG -3'
Posted On 2015-06-12