Incidental Mutation 'R4232:Ttc21a'
List |< first << previous [record 44 of 51] next >> last >|
ID320917
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119942618 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 161 (H161L)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: H161L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: H161L

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119954562 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 intron probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119952254 missense probably benign 0.02
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119959037 missense probably benign
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
RF004:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119942680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGATCTGGAAAGTAAGAGGTGTC -3'
(R):5'- ACACACCCAGAAGGATGGTC -3'

Sequencing Primer
(F):5'- ACACCACCTGGCAGAGGAG -3'
(R):5'- CTGGATCTCAGATCTGGCCTG -3'
Posted On2015-06-12