Incidental Mutation 'R4232:Olfr1535'
List |< first << previous [record 28 of 51] next >> last >|
ID320923
Institutional Source Beutler Lab
Gene Symbol Olfr1535
Ensembl Gene ENSMUSG00000054890
Gene Nameolfactory receptor 1535
SynonymsMOR256-36, Olfr1365, MOR256-63, GA_x6K02T2QHY8-11688984-11689964, MOR256-36
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21553894-21559893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21555461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 187 (D187G)
Ref Sequence ENSEMBL: ENSMUSP00000149589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068163] [ENSMUST00000217519]
Predicted Effect probably damaging
Transcript: ENSMUST00000068163
AA Change: D187G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064142
Gene: ENSMUSG00000054890
AA Change: D187G

DomainStartEndE-ValueType
Pfam:7tm_4 31 320 5.4e-46 PFAM
Pfam:7tm_1 41 302 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217519
AA Change: D187G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Olfr1535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Olfr1535 APN 13 21555219 missense probably damaging 0.98
IGL01866:Olfr1535 APN 13 21555173 missense probably benign 0.07
IGL02289:Olfr1535 APN 13 21555588 missense probably benign 0.02
IGL02350:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02357:Olfr1535 APN 13 21555602 missense probably damaging 1.00
IGL02793:Olfr1535 APN 13 21556002 missense probably damaging 1.00
IGL02875:Olfr1535 APN 13 21556002 missense probably damaging 1.00
R0785:Olfr1535 UTSW 13 21555788 missense probably benign 0.02
R1773:Olfr1535 UTSW 13 21555812 missense probably damaging 1.00
R3429:Olfr1535 UTSW 13 21555805 nonsense probably null
R3430:Olfr1535 UTSW 13 21555805 nonsense probably null
R4883:Olfr1535 UTSW 13 21555488 missense probably benign 0.22
R5586:Olfr1535 UTSW 13 21555096 missense probably damaging 1.00
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6032:Olfr1535 UTSW 13 21555907 missense probably benign 0.01
R6542:Olfr1535 UTSW 13 21555507 missense probably damaging 0.99
R7014:Olfr1535 UTSW 13 21555938 missense probably benign 0.02
R7579:Olfr1535 UTSW 13 21556006 missense probably benign 0.08
R7598:Olfr1535 UTSW 13 21555188 missense probably damaging 1.00
RF051:Olfr1535 UTSW 13 21555523 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGGTTCCAAAGGCCTTCC -3'
(R):5'- ATGATCGCTATGCTGCTGTCTG -3'

Sequencing Primer
(F):5'- CGCCTTCCCTGTGCTGAC -3'
(R):5'- ATGCTGCTGTCTGCCGAC -3'
Posted On2015-06-12