Incidental Mutation 'R4232:Samd8'
ID320925
Institutional Source Beutler Lab
Gene Symbol Samd8
Ensembl Gene ENSMUSG00000021770
Gene Namesterile alpha motif domain containing 8
Synonyms
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21750531-21798726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21780145 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 213 (Y213C)
Ref Sequence ENSEMBL: ENSMUSP00000112803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022292] [ENSMUST00000119430] [ENSMUST00000144061]
Predicted Effect probably benign
Transcript: ENSMUST00000022292
AA Change: Y276C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022292
Gene: ENSMUSG00000021770
AA Change: Y276C

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
SAM 72 141 1.86e-3 SMART
transmembrane domain 215 237 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Pfam:PAP2_C 355 428 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119430
AA Change: Y213C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112803
Gene: ENSMUSG00000021770
AA Change: Y213C

DomainStartEndE-ValueType
SAM 9 78 1.86e-3 SMART
transmembrane domain 152 174 N/A INTRINSIC
transmembrane domain 199 221 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Pfam:PAP2_C 292 365 6.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144061
SMART Domains Protein: ENSMUSP00000117603
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ceramide phosphoethanolamine synthase activity but normal liver, kidney and spleen histology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Samd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Samd8 APN 14 21780100 missense probably damaging 1.00
IGL01837:Samd8 APN 14 21774959 splice site probably benign
IGL02188:Samd8 APN 14 21783798 critical splice donor site probably null
IGL02338:Samd8 APN 14 21775476 missense possibly damaging 0.95
IGL02437:Samd8 APN 14 21775423 missense probably benign 0.11
IGL02643:Samd8 APN 14 21793144 missense probably damaging 1.00
skellington UTSW 14 21783798 critical splice donor site probably null
Stern UTSW 14 21775153 missense possibly damaging 0.79
wellington UTSW 14 21775137 missense probably damaging 1.00
R0993:Samd8 UTSW 14 21775495 missense probably damaging 1.00
R1529:Samd8 UTSW 14 21775159 missense possibly damaging 0.53
R2200:Samd8 UTSW 14 21775320 missense probably benign 0.00
R3801:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3803:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3981:Samd8 UTSW 14 21780180 missense probably null 1.00
R4094:Samd8 UTSW 14 21793045 missense probably damaging 1.00
R4847:Samd8 UTSW 14 21792435 missense possibly damaging 0.65
R5402:Samd8 UTSW 14 21775168 missense probably damaging 1.00
R5421:Samd8 UTSW 14 21792495 missense probably damaging 1.00
R5955:Samd8 UTSW 14 21793084 missense probably damaging 1.00
R6180:Samd8 UTSW 14 21775025 missense probably benign 0.04
R6447:Samd8 UTSW 14 21792556 critical splice donor site probably null
R6451:Samd8 UTSW 14 21783798 critical splice donor site probably null
R6844:Samd8 UTSW 14 21775137 missense probably damaging 1.00
R6914:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R6942:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R7101:Samd8 UTSW 14 21775374 missense probably benign 0.00
R7485:Samd8 UTSW 14 21792423 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGTGACGTTCTACAGAGC -3'
(R):5'- ACTAAGGCCGATATCCTTTTGC -3'

Sequencing Primer
(F):5'- AGTGACGTTCTACAGAGCAGTTC -3'
(R):5'- TCTTCCAGGGAAATGCAG -3'
Posted On2015-06-12