Incidental Mutation 'R4232:Ajuba'
ID320928
Institutional Source Beutler Lab
Gene Symbol Ajuba
Ensembl Gene ENSMUSG00000022178
Gene Nameajuba LIM protein
SynonymsJub
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54567472-54577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54569526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 490 (R490G)
Ref Sequence ENSEMBL: ENSMUSP00000056977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054487]
Predicted Effect probably damaging
Transcript: ENSMUST00000054487
AA Change: R490G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056977
Gene: ENSMUSG00000022178
AA Change: R490G

DomainStartEndE-ValueType
low complexity region 41 58 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
low complexity region 201 214 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 300 309 N/A INTRINSIC
LIM 346 399 1.41e-14 SMART
LIM 411 463 6.49e-14 SMART
LIM 471 532 2.89e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226463
Meta Mutation Damage Score 0.7971 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and reach adulthood without any obvious phenotypes, however mouse embryonic fibroblasts exhibit impaired cell migration and abnormal lamellipodia production in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Ajuba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ajuba APN 14 54571769 nonsense probably null
IGL02935:Ajuba APN 14 54570467 missense probably damaging 1.00
R2281:Ajuba UTSW 14 54577188 missense probably damaging 1.00
R4231:Ajuba UTSW 14 54569526 missense probably damaging 0.99
R4233:Ajuba UTSW 14 54569526 missense probably damaging 0.99
R4234:Ajuba UTSW 14 54569526 missense probably damaging 0.99
R4236:Ajuba UTSW 14 54569526 missense probably damaging 0.99
R4924:Ajuba UTSW 14 54571599 critical splice donor site probably null
R5384:Ajuba UTSW 14 54570398 missense probably damaging 1.00
R5385:Ajuba UTSW 14 54570398 missense probably damaging 1.00
R5386:Ajuba UTSW 14 54570398 missense probably damaging 1.00
R7199:Ajuba UTSW 14 54573458 nonsense probably null
R7570:Ajuba UTSW 14 54576402 missense probably damaging 0.99
R8221:Ajuba UTSW 14 54570390 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GACATAGGTCACTGCAGTGTC -3'
(R):5'- GCTAGCAAGTAAGGCTGAGC -3'

Sequencing Primer
(F):5'- ACTGCAGTGTCCTGGTTTTC -3'
(R):5'- CTGGTAGGAGTTGCTTAAAAGATCTC -3'
Posted On2015-06-12