Incidental Mutation 'R0396:Nedd4l'
ID 32093
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 038602-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R0396 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 65294725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000225261] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224890
Predicted Effect probably benign
Transcript: ENSMUST00000225261
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik G A 8: 106,436,412 (GRCm39) V194I probably benign Het
Acsm1 A T 7: 119,235,678 (GRCm39) I133F probably damaging Het
Adamts9 T A 6: 92,774,986 (GRCm39) T1676S probably benign Het
Adcy4 T C 14: 56,009,745 (GRCm39) D769G probably benign Het
Aif1 T C 17: 35,390,085 (GRCm39) *148W probably null Het
Akna C T 4: 63,310,363 (GRCm39) probably benign Het
Arhgap32 G A 9: 32,156,551 (GRCm39) probably null Het
Atpaf1 G A 4: 115,642,449 (GRCm39) E92K possibly damaging Het
Bltp2 T C 11: 78,159,203 (GRCm39) V467A possibly damaging Het
C1s1 T C 6: 124,510,313 (GRCm39) E378G probably benign Het
Caprin1 T A 2: 103,599,914 (GRCm39) Q108L probably damaging Het
Car13 A T 3: 14,721,299 (GRCm39) H154L probably benign Het
Cdon C A 9: 35,381,426 (GRCm39) N605K probably damaging Het
Ceacam10 G A 7: 24,480,439 (GRCm39) G70E probably damaging Het
Cfap221 G A 1: 119,881,930 (GRCm39) T286M probably benign Het
Cfap61 T C 2: 145,791,864 (GRCm39) F107S possibly damaging Het
Coil C A 11: 88,872,449 (GRCm39) T270N probably benign Het
Crocc2 T G 1: 93,151,936 (GRCm39) probably benign Het
Crot T C 5: 9,019,959 (GRCm39) E461G probably damaging Het
D130052B06Rik G T 11: 33,573,391 (GRCm39) R41L unknown Het
D630045J12Rik T C 6: 38,173,671 (GRCm39) S166G possibly damaging Het
Dennd4a T G 9: 64,769,673 (GRCm39) V460G probably damaging Het
Depdc7 A T 2: 104,557,668 (GRCm39) probably benign Het
Dgkb G A 12: 38,240,134 (GRCm39) probably null Het
Dhx57 T G 17: 80,582,226 (GRCm39) S407R probably benign Het
Dnase2a G T 8: 85,636,392 (GRCm39) probably benign Het
Dqx1 T G 6: 83,035,986 (GRCm39) M106R probably benign Het
Eno1b T C 18: 48,180,806 (GRCm39) I328T probably benign Het
Ephx2 T G 14: 66,345,512 (GRCm39) I151L probably benign Het
Gdf3 C T 6: 122,584,094 (GRCm39) G91D probably damaging Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gsdme T A 6: 50,198,087 (GRCm39) H291L probably benign Het
H2-T13 A G 17: 36,394,614 (GRCm39) I103T possibly damaging Het
Hif3a G A 7: 16,785,946 (GRCm39) probably benign Het
Hmox2 A T 16: 4,583,627 (GRCm39) I232L probably benign Het
Itgb2 A G 10: 77,397,023 (GRCm39) Y686C probably damaging Het
Jmjd1c A G 10: 67,055,302 (GRCm39) T528A possibly damaging Het
Kdr T C 5: 76,121,388 (GRCm39) I541V possibly damaging Het
Khdrbs2 C A 1: 32,559,054 (GRCm39) V343L probably damaging Het
Kif16b C T 2: 142,695,579 (GRCm39) R175H probably damaging Het
Klri2 T G 6: 129,717,251 (GRCm39) E44A possibly damaging Het
Kmt2b G T 7: 30,276,180 (GRCm39) T1773K probably damaging Het
Lair1 A G 7: 4,013,785 (GRCm39) L154P probably damaging Het
Larp1b G A 3: 40,924,996 (GRCm39) V158M probably damaging Het
Lgi3 T A 14: 70,772,280 (GRCm39) I275N probably damaging Het
Lrba A G 3: 86,202,486 (GRCm39) N246D probably damaging Het
Lrrc45 T A 11: 120,605,733 (GRCm39) probably benign Het
Mdh2 G T 5: 135,818,533 (GRCm39) V263L probably benign Het
Myom1 T A 17: 71,341,688 (GRCm39) V149E probably damaging Het
Nanos1 A T 19: 60,745,479 (GRCm39) D259V probably damaging Het
Npas3 A G 12: 53,878,528 (GRCm39) Y150C probably damaging Het
Or10ab4 A T 7: 107,655,170 (GRCm39) H327L probably benign Het
Or10ag59 T A 2: 87,405,911 (GRCm39) V161D possibly damaging Het
Or2h1b C T 17: 37,462,446 (GRCm39) C139Y probably damaging Het
Or2y1f A T 11: 49,184,165 (GRCm39) I6F probably benign Het
Or52e15 G A 7: 104,645,913 (GRCm39) A66V probably damaging Het
Or8k28 T C 2: 86,286,363 (GRCm39) N84S possibly damaging Het
Pde4c A G 8: 71,202,725 (GRCm39) N637S probably benign Het
Pds5b T A 5: 150,702,740 (GRCm39) V824D possibly damaging Het
Pole2 A T 12: 69,269,160 (GRCm39) probably benign Het
Ppig C T 2: 69,566,320 (GRCm39) probably benign Het
Prep A G 10: 44,968,772 (GRCm39) Y90C probably damaging Het
Proca1 A T 11: 78,085,731 (GRCm39) R11S probably damaging Het
Prph T A 15: 98,954,872 (GRCm39) W313R probably benign Het
Prune2 C T 19: 17,100,444 (GRCm39) P1983S probably benign Het
Ptbp2 G A 3: 119,517,847 (GRCm39) probably benign Het
Rsph6a C T 7: 18,808,031 (GRCm39) P398L probably damaging Het
Sdk2 T C 11: 113,720,793 (GRCm39) I1379V probably benign Het
Sf3b1 C T 1: 55,058,430 (GRCm39) G53E probably damaging Het
Slc9a3 T C 13: 74,305,903 (GRCm39) probably null Het
Smarcal1 A T 1: 72,665,632 (GRCm39) H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,059,142 (GRCm39) probably benign Het
Sptan1 T C 2: 29,881,045 (GRCm39) V438A probably damaging Het
Sstr4 T A 2: 148,238,181 (GRCm39) V264D probably damaging Het
Susd2 A G 10: 75,475,745 (GRCm39) L418P probably damaging Het
Synj1 A G 16: 90,735,528 (GRCm39) V1475A probably benign Het
Szt2 G A 4: 118,233,544 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,695,499 (GRCm39) probably null Het
Tesk1 A G 4: 43,446,000 (GRCm39) E311G probably damaging Het
Tmed5 A T 5: 108,273,882 (GRCm39) V119E probably damaging Het
Tmem260 T C 14: 48,724,324 (GRCm39) S201P possibly damaging Het
Tnxb A G 17: 34,890,707 (GRCm39) Y350C probably damaging Het
Tpte T C 8: 22,825,624 (GRCm39) probably benign Het
Trim37 A T 11: 87,037,794 (GRCm39) D161V probably damaging Het
Trrap C A 5: 144,751,366 (GRCm39) Q1640K probably damaging Het
Tspoap1 T C 11: 87,667,172 (GRCm39) probably benign Het
Ttk T A 9: 83,729,313 (GRCm39) probably benign Het
Vmn1r172 A G 7: 23,359,957 (GRCm39) S281G probably benign Het
Vmn1r177 A G 7: 23,565,022 (GRCm39) S285P probably damaging Het
Vmn1r231 C T 17: 21,110,661 (GRCm39) V85I probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r118 T C 17: 55,915,643 (GRCm39) I436V probably benign Het
Vmn2r12 T C 5: 109,240,765 (GRCm39) K116R probably benign Het
Vmn2r28 T A 7: 5,491,513 (GRCm39) I245L probably benign Het
Wdr26 A T 1: 181,008,216 (GRCm39) probably benign Het
Xrcc3 A T 12: 111,776,391 (GRCm39) H67Q probably benign Het
Zbbx A T 3: 74,985,802 (GRCm39) S417T possibly damaging Het
Zc3h13 A G 14: 75,560,922 (GRCm39) D504G unknown Het
Zfp1005 G A 2: 150,109,973 (GRCm39) G221D probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zyg11b A T 4: 108,112,505 (GRCm39) F388I probably damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATGGCTCTGAATACCCCTTC -3'
(R):5'- TTGCCCATGAGACCCAGACAAGTG -3'

Sequencing Primer
(F):5'- GGCTCTGAATACCCCTTCTCTTC -3'
(R):5'- GGTCAAACGTTGGTTTCACAAG -3'
Posted On 2013-04-24