Incidental Mutation 'R4232:Dnaja3'
ID320931
Institutional Source Beutler Lab
Gene Symbol Dnaja3
Ensembl Gene ENSMUSG00000004069
Gene NameDnaJ heat shock protein family (Hsp40) member A3
Synonyms1810053A11Rik, 1200003J13Rik, Tid-1
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4232 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4639989-4707695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4699871 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 322 (N322K)
Ref Sequence ENSEMBL: ENSMUSP00000155588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060067] [ENSMUST00000115854] [ENSMUST00000229529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060067
AA Change: N373K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053842
Gene: ENSMUSG00000004069
AA Change: N373K

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_C 209 413 4.4e-23 PFAM
Pfam:DnaJ_CXXCXGXG 236 296 2.4e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115854
AA Change: N373K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111520
Gene: ENSMUSG00000004069
AA Change: N373K

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
DnaJ 92 150 4.57e-31 SMART
Pfam:DnaJ_CXXCXGXG 236 296 3.9e-14 PFAM
Pfam:CTDII 345 423 1.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229529
AA Change: N322K

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ/Hsp40 protein family. DNAJ/Hsp40 proteins stimulate the ATPase activity of Hsp70 chaperones and play critical roles in protein folding, degradation, and multimeric complex assembly. The encoded protein is localized to mitochondria and mediates several cellular processes including proliferation, survival and apoptotic signal transduction. The encoded protein also plays a critical role in tumor suppression through interactions with oncogenic proteins including ErbB2 and the p53 tumor suppressor protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Early embryonic development of homozygous null embryos is disrupted. Blastocysts develop and implant but die afterwards. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Dvl3 A G 16: 20,524,233 probably benign Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Dnaja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Dnaja3 APN 16 4694445 missense probably damaging 1.00
IGL01531:Dnaja3 APN 16 4694404 missense probably damaging 1.00
IGL01607:Dnaja3 APN 16 4693395 missense probably damaging 1.00
IGL01981:Dnaja3 APN 16 4701169 missense probably damaging 1.00
IGL02312:Dnaja3 APN 16 4694436 missense probably benign 0.02
IGL02473:Dnaja3 APN 16 4701240 nonsense probably null
IGL02795:Dnaja3 APN 16 4690073 splice site probably benign
R1334:Dnaja3 UTSW 16 4699794 missense probably damaging 1.00
R1700:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1733:Dnaja3 UTSW 16 4684165 missense probably null 0.02
R1854:Dnaja3 UTSW 16 4697269 missense probably damaging 1.00
R2330:Dnaja3 UTSW 16 4690016 missense probably benign 0.01
R4357:Dnaja3 UTSW 16 4699867 missense probably damaging 0.96
R4434:Dnaja3 UTSW 16 4689995 nonsense probably null
R5072:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5073:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5074:Dnaja3 UTSW 16 4696425 missense probably damaging 0.96
R5160:Dnaja3 UTSW 16 4684288 missense probably benign 0.01
R5174:Dnaja3 UTSW 16 4684297 missense probably benign
R5347:Dnaja3 UTSW 16 4694482 missense possibly damaging 0.78
R7106:Dnaja3 UTSW 16 4705934 missense probably benign 0.13
R7214:Dnaja3 UTSW 16 4701182 missense possibly damaging 0.61
R7673:Dnaja3 UTSW 16 4694464 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTTAAAGTGTGTCAGGTTCCAAGG -3'
(R):5'- TGCACATGGATGCAAACCTAAC -3'

Sequencing Primer
(F):5'- AGACACATGGCTGGTGTCTAGC -3'
(R):5'- CCTAACACAGGGAAGGCAACTG -3'
Posted On2015-06-12