Incidental Mutation 'R4232:Dvl3'
ID 320933
Institutional Source Beutler Lab
Gene Symbol Dvl3
Ensembl Gene ENSMUSG00000003233
Gene Name dishevelled segment polarity protein 3
Synonyms
MMRRC Submission 041051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4232 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20516982-20534010 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 20524233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003318] [ENSMUST00000171572] [ENSMUST00000171774]
AlphaFold Q61062
Predicted Effect probably benign
Transcript: ENSMUST00000003318
SMART Domains Protein: ENSMUSP00000003318
Gene: ENSMUSG00000003233

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 1.6e-36 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 5.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169552
Predicted Effect probably benign
Transcript: ENSMUST00000171572
SMART Domains Protein: ENSMUSP00000130925
Gene: ENSMUSG00000003233

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 89 245 1.3e-63 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 378 396 N/A INTRINSIC
DEP 422 496 3.43e-27 SMART
Pfam:Dsh_C 500 706 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171774
SMART Domains Protein: ENSMUSP00000126082
Gene: ENSMUSG00000003233

DomainStartEndE-ValueType
DAX 1 82 3.17e-54 SMART
Pfam:Dishevelled 142 213 3.9e-37 PFAM
PDZ 258 337 2.92e-16 SMART
low complexity region 361 379 N/A INTRINSIC
DEP 405 479 3.43e-27 SMART
Pfam:Dsh_C 483 689 1.8e-88 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (58/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a multi-gene family which shares strong similarity with the Drosophila dishevelled gene, dsh. The Drosophila dishevelled gene encodes a cytoplasmic phosphoprotein that regulates cell proliferation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with respiratory distress, persistent truncus arteriosis, and double outlet right ventricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Aven A G 2: 112,627,768 D167G probably damaging Het
Celsr2 A G 3: 108,413,772 F575L probably benign Het
Cflar A T 1: 58,740,993 Q249L possibly damaging Het
Col7a1 G A 9: 108,972,813 probably null Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah1 T C 14: 31,304,916 N717S probably benign Het
Dnaja3 T A 16: 4,699,871 N322K possibly damaging Het
Dnajb3 A G 1: 88,205,252 S143P possibly damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam71b C A 11: 46,407,405 T512K possibly damaging Het
Fkbp7 A T 2: 76,663,317 D177E possibly damaging Het
Galnt7 T C 8: 57,652,966 I5V probably benign Het
Helz2 A T 2: 181,229,902 L2639Q probably damaging Het
Hnrnpr T C 4: 136,339,189 M394T probably benign Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kif14 T A 1: 136,516,363 C1364* probably null Het
Macf1 T C 4: 123,432,392 E5104G probably damaging Het
Mkl1 T A 15: 81,023,595 K29M probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mtbp CATGA CATGAATGA 15: 55,620,677 probably null Het
Nfkb1 A G 3: 135,603,770 V521A probably damaging Het
Olfr1535 T C 13: 21,555,461 D187G probably damaging Het
Olfr850 G T 9: 19,477,726 L175M probably damaging Het
P2rx6 T C 16: 17,570,767 L335P probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Pgpep1l T C 7: 68,237,079 T161A probably benign Het
Prss40 A G 1: 34,560,792 V38A probably benign Het
Ptk2 C A 15: 73,309,849 R104L possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rtp4 A G 16: 23,613,083 N122D possibly damaging Het
Samd8 A G 14: 21,780,145 Y213C probably benign Het
Shcbp1 T A 8: 4,736,372 T577S probably benign Het
Tiprl A G 1: 165,222,587 V153A probably damaging Het
Tmprss7 A T 16: 45,656,573 D775E probably damaging Het
Tnr T C 1: 159,886,215 S738P possibly damaging Het
Tsc22d4 T C 5: 137,751,370 probably null Het
Ttc21a A T 9: 119,942,618 H161L probably benign Het
Ubqln3 T A 7: 104,141,803 E360V probably benign Het
Ugt1a10 C A 1: 88,056,210 D243E probably benign Het
Vmn2r19 G A 6: 123,329,912 V460I probably benign Het
Vmn2r58 T A 7: 41,837,587 Y628F possibly damaging Het
Wnk1 A T 6: 119,949,261 S1588T possibly damaging Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Zfp831 G C 2: 174,705,654 W1543C possibly damaging Het
Other mutations in Dvl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Dvl3 APN 16 20530939 missense probably damaging 0.97
IGL02318:Dvl3 APN 16 20523743 missense possibly damaging 0.52
R0490:Dvl3 UTSW 16 20527423 splice site probably benign
R0491:Dvl3 UTSW 16 20527423 splice site probably benign
R1356:Dvl3 UTSW 16 20524305 small deletion probably benign
R1502:Dvl3 UTSW 16 20523459 missense probably damaging 0.99
R2062:Dvl3 UTSW 16 20526351 missense probably benign 0.33
R2197:Dvl3 UTSW 16 20523756 missense probably damaging 0.99
R4346:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4347:Dvl3 UTSW 16 20531299 missense possibly damaging 0.95
R4350:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4351:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R4352:Dvl3 UTSW 16 20525644 missense possibly damaging 0.93
R5129:Dvl3 UTSW 16 20517340 missense possibly damaging 0.95
R5134:Dvl3 UTSW 16 20524607 intron probably benign
R5430:Dvl3 UTSW 16 20523731 missense probably damaging 1.00
R5586:Dvl3 UTSW 16 20517289 missense probably damaging 0.98
R5643:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5644:Dvl3 UTSW 16 20526276 missense probably damaging 0.99
R5961:Dvl3 UTSW 16 20530979 missense possibly damaging 0.86
R6143:Dvl3 UTSW 16 20527039 missense possibly damaging 0.92
R6502:Dvl3 UTSW 16 20527383 missense probably damaging 1.00
R7117:Dvl3 UTSW 16 20527322 nonsense probably null
R7740:Dvl3 UTSW 16 20527250 critical splice acceptor site probably null
R8344:Dvl3 UTSW 16 20523763 critical splice donor site probably null
R8828:Dvl3 UTSW 16 20525745 missense probably damaging 1.00
R9047:Dvl3 UTSW 16 20524076 critical splice donor site probably null
R9518:Dvl3 UTSW 16 20517211 missense possibly damaging 0.79
R9610:Dvl3 UTSW 16 20527258 missense probably damaging 1.00
X0062:Dvl3 UTSW 16 20523495 missense probably damaging 1.00
Z1176:Dvl3 UTSW 16 20530881 missense probably damaging 0.97
Z1177:Dvl3 UTSW 16 20517088 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCATCTACCCTCATGAGCAGC -3'
(R):5'- GGAAGGACTCACAGTCTAACC -3'

Sequencing Primer
(F):5'- TCCGATGAGGATGATTCCACCAG -3'
(R):5'- GGACTCACAGTCTAACCTCCTG -3'
Posted On 2015-06-12