Incidental Mutation 'R4233:Gpa33'
ID320941
Institutional Source Beutler Lab
Gene Symbol Gpa33
Ensembl Gene ENSMUSG00000000544
Gene Nameglycoprotein A33 (transmembrane)
Synonyms2010310L10Rik, A33 antigen, 2210401D16Rik
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166130238-166166510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 166146771 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 59 (D59V)
Ref Sequence ENSEMBL: ENSMUSP00000125903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060833] [ENSMUST00000166159] [ENSMUST00000166860]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027847
Predicted Effect probably damaging
Transcript: ENSMUST00000060833
AA Change: D59V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060147
Gene: ENSMUSG00000000544
AA Change: D59V

DomainStartEndE-ValueType
IGv 38 119 1.26e-9 SMART
IGc2 153 218 3.03e-12 SMART
transmembrane domain 235 257 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166159
Predicted Effect probably damaging
Transcript: ENSMUST00000166860
AA Change: D59V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125903
Gene: ENSMUSG00000000544
AA Change: D59V

DomainStartEndE-ValueType
IGv 38 119 1.26e-9 SMART
IGc2 153 218 3.03e-12 SMART
transmembrane domain 235 257 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Meta Mutation Damage Score 0.4384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycoprotein encoded by this gene is a cell surface antigen that is expressed in greater than 95% of human colon cancers. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. The sequence of the extracellular region contains 2 domains characteristic of the CD2 subgroup of the immunoglobulin (Ig) superfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis and impaired oral tolerance to ovalbumin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Gpa33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Gpa33 APN 1 166165216 missense probably benign 0.11
IGL03051:Gpa33 APN 1 166165221 missense probably benign
IGL03132:Gpa33 APN 1 166152649 missense probably benign 0.00
R0433:Gpa33 UTSW 1 166163761 splice site probably benign
R0892:Gpa33 UTSW 1 166157642 missense probably damaging 0.98
R1854:Gpa33 UTSW 1 166165190 missense probably benign 0.00
R4354:Gpa33 UTSW 1 166163835 missense possibly damaging 0.95
R5652:Gpa33 UTSW 1 166165145 critical splice acceptor site probably null
R5667:Gpa33 UTSW 1 166146791 missense possibly damaging 0.63
R5671:Gpa33 UTSW 1 166146791 missense possibly damaging 0.63
R5884:Gpa33 UTSW 1 166152760 missense probably damaging 0.98
R5918:Gpa33 UTSW 1 166130538 unclassified probably null
R7402:Gpa33 UTSW 1 166152694 missense probably damaging 0.99
Z1176:Gpa33 UTSW 1 166164671 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGCTTTCATACAGCCAC -3'
(R):5'- GTCCACAACTCAGTAATAGAATCAG -3'

Sequencing Primer
(F):5'- CTTGCAGCGGTCTGAAGATAGC -3'
(R):5'- ACTCAGTAATAGAATCAGATCACAGG -3'
Posted On2015-06-12