Incidental Mutation 'R4233:Tmem38b'
List |< first << previous [record 48 of 50] next >> last >|
ID320950
Institutional Source Beutler Lab
Gene Symbol Tmem38b
Ensembl Gene ENSMUSG00000028420
Gene Nametransmembrane protein 38B
Synonyms1600017F22Rik, TRIC-B, D4Ertd89e
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53826045-53862019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53840710 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 66 (C66R)
Ref Sequence ENSEMBL: ENSMUSP00000030127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030127] [ENSMUST00000144167]
Predicted Effect probably damaging
Transcript: ENSMUST00000030127
AA Change: C66R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030127
Gene: ENSMUSG00000028420
AA Change: C66R

DomainStartEndE-ValueType
Pfam:TRIC 36 227 4.1e-81 PFAM
low complexity region 249 256 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144167
AA Change: C42R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120304
Gene: ENSMUSG00000028420
AA Change: C42R

DomainStartEndE-ValueType
Pfam:TRIC 9 164 3.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151206
Meta Mutation Damage Score 0.4782 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous null newborn mice die of respiratory failure showing atelectasis, pulmonary congestion, impaired maturation of alveolar type II cells, reduced lamellar body formation, abnormal synthesis and secretion of surfactant phospholipids, and impaired Ca2+ release in alveolar type II cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Tmem38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Tmem38b APN 4 53849024 missense probably damaging 1.00
IGL01948:Tmem38b APN 4 53850530 missense probably damaging 0.97
IGL02383:Tmem38b APN 4 53854345 missense probably benign
IGL02619:Tmem38b APN 4 53848871 missense probably damaging 1.00
R0266:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R0849:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R1658:Tmem38b UTSW 4 53840713 missense probably benign
R3845:Tmem38b UTSW 4 53859905 missense probably benign 0.10
R3930:Tmem38b UTSW 4 53854398 missense probably damaging 1.00
R4012:Tmem38b UTSW 4 53854409 missense probably benign 0.01
R4235:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R5388:Tmem38b UTSW 4 53859945 missense probably benign 0.04
R5708:Tmem38b UTSW 4 53849051 critical splice donor site probably null
R6083:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R8272:Tmem38b UTSW 4 53854332 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCATGATGAGCACACTTG -3'
(R):5'- GGGTTCGTTCATTGCACATGC -3'

Sequencing Primer
(F):5'- TTTCGGGAAATAAATCAACAAACGC -3'
(R):5'- GATCTCATAGTGCAGCCTAA -3'
Posted On2015-06-12