Incidental Mutation 'R4233:Skint11'
ID320951
Institutional Source Beutler Lab
Gene Symbol Skint11
Ensembl Gene ENSMUSG00000057977
Gene Nameselection and upkeep of intraepithelial T cells 11
SynonymsA630098G03Rik
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location114163384-114245028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114244659 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 99 (Q99K)
Ref Sequence ENSEMBL: ENSMUSP00000078836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079915] [ENSMUST00000164297]
Predicted Effect probably benign
Transcript: ENSMUST00000079915
AA Change: Q99K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078836
Gene: ENSMUSG00000057977
AA Change: Q99K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164297
AA Change: Q290K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127138
Gene: ENSMUSG00000057977
AA Change: Q290K

DomainStartEndE-ValueType
PDB:4F8T|A 19 125 6e-9 PDB
Blast:IG_like 40 119 1e-10 BLAST
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Skint11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Skint11 APN 4 114194709 missense probably benign 0.03
IGL00775:Skint11 APN 4 114194692 missense probably damaging 1.00
IGL02186:Skint11 APN 4 114244636 missense possibly damaging 0.82
IGL02499:Skint11 APN 4 114194604 missense probably benign 0.01
IGL02622:Skint11 APN 4 114194728 missense probably damaging 1.00
IGL03115:Skint11 APN 4 114244623 missense probably damaging 0.99
R0513:Skint11 UTSW 4 114194565 missense probably benign 0.00
R0928:Skint11 UTSW 4 114244601 missense possibly damaging 0.95
R1486:Skint11 UTSW 4 114194818 critical splice donor site probably null
R1508:Skint11 UTSW 4 114231766 critical splice donor site probably null
R1667:Skint11 UTSW 4 114194781 missense probably damaging 0.99
R1807:Skint11 UTSW 4 114194696 missense probably benign 0.08
R2504:Skint11 UTSW 4 114228812 missense possibly damaging 0.55
R4165:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4166:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4231:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4234:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4236:Skint11 UTSW 4 114244659 missense probably benign 0.00
R4756:Skint11 UTSW 4 114194677 missense probably benign 0.30
R4947:Skint11 UTSW 4 114191510 missense possibly damaging 0.89
R5237:Skint11 UTSW 4 114244845 missense possibly damaging 0.66
R5538:Skint11 UTSW 4 114231762 missense probably damaging 0.99
R5555:Skint11 UTSW 4 114194601 missense probably benign 0.03
R6004:Skint11 UTSW 4 114231728 missense probably benign 0.37
R6209:Skint11 UTSW 4 114244710 missense possibly damaging 0.73
R7121:Skint11 UTSW 4 114227796 missense probably benign 0.05
R7208:Skint11 UTSW 4 114231747 missense probably damaging 1.00
R7348:Skint11 UTSW 4 114244722 missense probably benign 0.15
R7763:Skint11 UTSW 4 114227708 missense probably benign 0.00
R7842:Skint11 UTSW 4 114244771 missense possibly damaging 0.83
R7846:Skint11 UTSW 4 114244879 missense possibly damaging 0.92
R8054:Skint11 UTSW 4 114244609 missense possibly damaging 0.55
Z1176:Skint11 UTSW 4 114194772 missense probably damaging 1.00
Z1176:Skint11 UTSW 4 114231681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTGAACAACAAGTTGCAGTGAG -3'
(R):5'- GTGTCAAGTTTCCAAGTTTCGAGTAC -3'

Sequencing Primer
(F):5'- CAACAAGTTGCAGTGAGAGTGTGTG -3'
(R):5'- AGTTTCCAAGTTTCGAGTACAATTC -3'
Posted On2015-06-12