Incidental Mutation 'R4233:Ldlrap1'
List |< first << previous [record 29 of 50] next >> last >|
ID320953
Institutional Source Beutler Lab
Gene Symbol Ldlrap1
Ensembl Gene ENSMUSG00000037295
Gene Namelow density lipoprotein receptor adaptor protein 1
SynonymsArh, Arh1
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134741554-134768024 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 134757338 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037828]
Predicted Effect probably null
Transcript: ENSMUST00000037828
SMART Domains Protein: ENSMUSP00000036749
Gene: ENSMUSG00000037295

DomainStartEndE-ValueType
PTB 42 177 4.92e-40 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic protein which contains a phosphotyrosine binding (PTD) domain. The PTD domain has been found to interact with the cytoplasmic tail of the LDL receptor. Mutations in this gene lead to LDL receptor malfunction and cause the disorder autosomal recessive hypercholesterolaemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have increased levels of circulating LDL cholesterol and total plasmsa cholesterol and are physiologically similar to humans with autosomal recessive hypercholesterolemia (ARH). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Ldlrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01076:Ldlrap1 APN 4 134749982 missense probably benign 0.03
IGL02303:Ldlrap1 APN 4 134757395 missense probably damaging 1.00
R0129:Ldlrap1 UTSW 4 134757422 missense probably damaging 1.00
R3841:Ldlrap1 UTSW 4 134750436 missense probably damaging 0.97
R4884:Ldlrap1 UTSW 4 134758971 missense probably benign
R5871:Ldlrap1 UTSW 4 134758929 missense probably damaging 1.00
R6221:Ldlrap1 UTSW 4 134757360 missense probably damaging 0.96
R6222:Ldlrap1 UTSW 4 134757360 missense probably damaging 0.96
R6232:Ldlrap1 UTSW 4 134759034 missense possibly damaging 0.82
R6939:Ldlrap1 UTSW 4 134767974 start gained probably benign
R7472:Ldlrap1 UTSW 4 134758996 missense possibly damaging 0.61
R8407:Ldlrap1 UTSW 4 134757425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCTGGTTAGGGAACAGC -3'
(R):5'- CAAGGTGCCAGTTGAGTGTC -3'

Sequencing Primer
(F):5'- GGGTTTCTCAGTGGCACAACATAAC -3'
(R):5'- GCCAGTTGAGTGTCCTCCTG -3'
Posted On2015-06-12