Mutagenetix > Incidental Mutations

Incidental Mutation 'R4233:Stard13'

320957

Institutional Source

Beutler Lab

Gene Symbol

Stard13

Ensembl Gene

ENSMUSG00000016128

Gene Name

StAR-related lipid transfer (START) domain containing 13

Synonyms

GT650, DLC2

MMRRC Submission

041642-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4233 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151037510-151233836 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 151062699 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 331 (S331P)

Ref Sequence

ENSEMBL: ENSMUSP00000144056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]

Predicted Effect

probably benign
Transcript: ENSMUST00000062015
AA Change: S449P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: S449P

Domain	Start	End	E-Value	Type
Pfam:SAM_2	59	120	2.6e-6	PFAM
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	693	884	2.37e-50	SMART
START	927	1129	2.08e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110483
AA Change: S449P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: S449P

Domain	Start	End	E-Value	Type
PDB:2JW2\|A	50	120	1e-37	PDB
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	674	865	2.37e-50	SMART
START	908	1110	2.08e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129088

SMART Domains

Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

Domain	Start	End	E-Value	Type
Blast:SAM	40	104	6e-32	BLAST
PDB:2JW2\|A	42	104	8e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201680

Predicted Effect

probably benign
Transcript: ENSMUST00000202111
AA Change: S331P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: S331P

Domain	Start	End	E-Value	Type
low complexity region	79	98	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
RhoGAP	556	747	1.4e-52	SMART
START	790	992	1.4e-42	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202385

Meta Mutation Damage Score

0.0966

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,564,192	Y96N	probably damaging	Het
Abca15	C	T	7: 120,402,979	Q1572*	probably null	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aph1c	A	G	9: 66,833,321	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Arhgef40	T	C	14: 51,990,171	V458A	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Ccar2	T	C	14: 70,151,091	T169A	possibly damaging	Het
Cfap58	G	A	19: 47,975,555	V541M	possibly damaging	Het
Coro2b	T	C	9: 62,426,185	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,916,791	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360	E1549G	probably benign	Het
Ercc6l2	T	C	13: 63,872,168		probably benign	Het
Fam160b2	A	C	14: 70,586,878	V473G	probably damaging	Het
Fbxo32	G	T	15: 58,192,333	T135K	possibly damaging	Het
Fras1	A	T	5: 96,714,376	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,446,785		noncoding transcript	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Gm5108	C	A	5: 67,975,153	T55K	unknown	Het
Gpa33	A	T	1: 166,146,771	D59V	probably damaging	Het
Gpn2	T	A	4: 133,584,705	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,686,533	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,936,533	S124R	possibly damaging	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ldlrap1	T	A	4: 134,757,338		probably null	Het
Madd	T	C	2: 91,178,236	E107G	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr658	A	G	7: 104,644,988	V126A	probably benign	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	T	1: 97,864,394	V434D	possibly damaging	Het
Plxnd1	T	C	6: 115,965,953	N1257D	probably benign	Het
Prkdc	C	T	16: 15,835,919	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	T	C	13: 11,750,725	D1375G	probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,403,535		probably benign	Het
Slc7a13	T	C	4: 19,819,070	F90S	probably damaging	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Sult2a8	T	A	7: 14,413,683	I228L	probably benign	Het
Tas2r140	A	T	6: 133,054,952	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tshz1	C	A	18: 84,016,195	E29D	probably benign	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Stard13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Stard13	APN	5	151042239	missense	probably damaging	1.00
IGL01362:Stard13	APN	5	151189952	missense	probably benign	0.05
IGL01588:Stard13	APN	5	151045237	missense	probably damaging	1.00
IGL01947:Stard13	APN	5	151062844	missense	probably damaging	1.00
IGL02294:Stard13	APN	5	151063115	missense	probably benign	0.19
IGL02713:Stard13	APN	5	151042186	nonsense	probably null
IGL02746:Stard13	APN	5	151046857	splice site	probably benign
IGL02827:Stard13	APN	5	151063126	missense	probably benign	0.07
R0498:Stard13	UTSW	5	151052477	missense	probably damaging	1.00
R1427:Stard13	UTSW	5	151045991	missense	probably damaging	0.99
R1785:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R1857:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R1858:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R2130:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2131:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2132:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2133:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2258:Stard13	UTSW	5	151039731	missense	probably damaging	1.00
R3435:Stard13	UTSW	5	151042179	missense	probably damaging	1.00
R4080:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4081:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4082:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4288:Stard13	UTSW	5	151045177	missense	probably damaging	1.00
R4303:Stard13	UTSW	5	151062869	missense	possibly damaging	0.82
R4659:Stard13	UTSW	5	151062788	missense	probably benign	0.01
R4695:Stard13	UTSW	5	151060815	missense	probably benign	0.08
R4910:Stard13	UTSW	5	151062527	missense	probably benign
R5135:Stard13	UTSW	5	151062767	nonsense	probably null
R5338:Stard13	UTSW	5	151059598	missense	probably damaging	1.00
R5399:Stard13	UTSW	5	151047801	nonsense	probably null
R5546:Stard13	UTSW	5	151045901	missense	probably benign	0.03
R5685:Stard13	UTSW	5	151063127	missense	possibly damaging	0.78
R5771:Stard13	UTSW	5	151190011	missense	probably damaging	1.00
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6141:Stard13	UTSW	5	151042242	missense	probably damaging	1.00
R6171:Stard13	UTSW	5	151092762	missense	probably damaging	1.00
R6296:Stard13	UTSW	5	151062673	missense	probably damaging	1.00
R6326:Stard13	UTSW	5	151046919	missense	possibly damaging	0.95
R6508:Stard13	UTSW	5	151063289	missense	probably benign	0.06
R7252:Stard13	UTSW	5	151063169	missense	probably benign	0.01
R7318:Stard13	UTSW	5	151062573	nonsense	probably null
R7459:Stard13	UTSW	5	151047599	missense	probably damaging	1.00
R7571:Stard13	UTSW	5	151059502	missense	probably damaging	0.97
R7696:Stard13	UTSW	5	151060802	missense	probably damaging	0.99
R7809:Stard13	UTSW	5	151190024	missense	probably damaging	0.98
Z1177:Stard13	UTSW	5	151063334	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AATGTGCTGTGACTTTGCAG -3'
(R):5'- CATGCATGGGTTTCACTCCC -3'

Sequencing Primer
(F):5'- ACTTTGCAGTTCGGGTAAGATG -3'
(R):5'- GGGTTTCACTCCCAAGAAAACTTG -3'

Posted On

2015-06-12