Incidental Mutation 'R4233:Olfr849'
ID320965
Institutional Source Beutler Lab
Gene Symbol Olfr849
Ensembl Gene ENSMUSG00000052182
Gene Nameolfactory receptor 849
SynonymsMOR151-1, GA_x6K02T2PVTD-13176842-13177780
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19440266-19446923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19441590 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 226 (L226I)
Ref Sequence ENSEMBL: ENSMUSP00000149769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063923] [ENSMUST00000217273]
Predicted Effect probably damaging
Transcript: ENSMUST00000063923
AA Change: L226I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064123
Gene: ENSMUSG00000052182
AA Change: L226I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157237
Predicted Effect probably damaging
Transcript: ENSMUST00000217273
AA Change: L226I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Olfr849
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr849 APN 9 19440970 missense probably benign 0.01
IGL01599:Olfr849 APN 9 19441815 missense probably benign 0.00
IGL01885:Olfr849 APN 9 19441464 missense probably benign 0.01
IGL02258:Olfr849 APN 9 19440997 missense possibly damaging 0.66
IGL02258:Olfr849 APN 9 19440999 missense probably benign 0.00
IGL02282:Olfr849 APN 9 19441618 missense probably benign 0.42
R1293:Olfr849 UTSW 9 19441432 missense probably benign 0.27
R1931:Olfr849 UTSW 9 19441351 missense possibly damaging 0.93
R2444:Olfr849 UTSW 9 19441015 missense possibly damaging 0.78
R4181:Olfr849 UTSW 9 19441735 missense possibly damaging 0.86
R4231:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4236:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4302:Olfr849 UTSW 9 19440999 missense probably benign 0.00
R4651:Olfr849 UTSW 9 19441295 nonsense probably null
R5006:Olfr849 UTSW 9 19441249 missense probably benign 0.30
R5088:Olfr849 UTSW 9 19441771 missense probably damaging 1.00
R5501:Olfr849 UTSW 9 19440994 missense possibly damaging 0.93
R6775:Olfr849 UTSW 9 19441422 missense possibly damaging 0.56
R7038:Olfr849 UTSW 9 19441592 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTGCATGCTTTGTTCCACAC -3'
(R):5'- AAAGGGGTTCAGCATCTGAG -3'

Sequencing Primer
(F):5'- GCTATCCTTCTGCACAGAAATTGAG -3'
(R):5'- TCTGAGTGATGATAGTGTACATCAC -3'
Posted On2015-06-12