Mutagenetix > Incidental Mutations

Incidental Mutation 'R4233:Impg1'

320971

Institutional Source

Beutler Lab

Gene Symbol

Impg1

Ensembl Gene

ENSMUSG00000032343

Gene Name

interphotoreceptor matrix proteoglycan 1

Synonyms

IMP150, SPACR, A930015H12Rik

MMRRC Submission

041642-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R4233 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80313330-80465481 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80345329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 523 (L523P)

Ref Sequence

ENSEMBL: ENSMUSP00000108876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250]

AlphaFold

Q8R1W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000085289
AA Change: L446P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: L446P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SEA	158	273	8.68e-1	SMART
low complexity region	353	374	N/A	INTRINSIC
SEA	494	616	1.37e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113250
AA Change: L523P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: L523P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SEA	235	350	8.68e-1	SMART
low complexity region	430	451	N/A	INTRINSIC
SEA	571	693	1.37e-11	SMART

Meta Mutation Damage Score

0.2382

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,564,192	Y96N	probably damaging	Het
Abca15	C	T	7: 120,402,979	Q1572*	probably null	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aph1c	A	G	9: 66,833,321	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Arhgef40	T	C	14: 51,990,171	V458A	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Ccar2	T	C	14: 70,151,091	T169A	possibly damaging	Het
Cfap58	G	A	19: 47,975,555	V541M	possibly damaging	Het
Coro2b	T	C	9: 62,426,185	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,916,791	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360	E1549G	probably benign	Het
Ercc6l2	T	C	13: 63,872,168		probably benign	Het
Fam160b2	A	C	14: 70,586,878	V473G	probably damaging	Het
Fbxo32	G	T	15: 58,192,333	T135K	possibly damaging	Het
Fras1	A	T	5: 96,714,376	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,446,785		noncoding transcript	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Gm5108	C	A	5: 67,975,153	T55K	unknown	Het
Gpa33	A	T	1: 166,146,771	D59V	probably damaging	Het
Gpn2	T	A	4: 133,584,705	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,686,533	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,936,533	S124R	possibly damaging	Het
Ldlrap1	T	A	4: 134,757,338		probably null	Het
Madd	T	C	2: 91,178,236	E107G	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr658	A	G	7: 104,644,988	V126A	probably benign	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	T	1: 97,864,394	V434D	possibly damaging	Het
Plxnd1	T	C	6: 115,965,953	N1257D	probably benign	Het
Prkdc	C	T	16: 15,835,919	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	T	C	13: 11,750,725	D1375G	probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,403,535		probably benign	Het
Slc7a13	T	C	4: 19,819,070	F90S	probably damaging	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Stard13	A	G	5: 151,062,699	S331P	probably benign	Het
Sult2a8	T	A	7: 14,413,683	I228L	probably benign	Het
Tas2r140	A	T	6: 133,054,952	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tshz1	C	A	18: 84,016,195	E29D	probably benign	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Impg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Impg1	APN	9	80322829	missense	probably benign	0.02
IGL01733:Impg1	APN	9	80341924	missense	probably damaging	0.99
IGL02333:Impg1	APN	9	80440755	missense	possibly damaging	0.74
IGL03097:Impg1	UTSW	9	80379952	missense	possibly damaging	0.48
R0021:Impg1	UTSW	9	80435426	missense	probably damaging	1.00
R0029:Impg1	UTSW	9	80398371	missense	probably damaging	1.00
R0029:Impg1	UTSW	9	80398371	missense	probably damaging	1.00
R0108:Impg1	UTSW	9	80322848	missense	possibly damaging	0.63
R0201:Impg1	UTSW	9	80345561	missense	probably damaging	1.00
R0271:Impg1	UTSW	9	80386879	splice site	probably benign
R0316:Impg1	UTSW	9	80342065	missense	probably damaging	1.00
R0492:Impg1	UTSW	9	80345308	missense	possibly damaging	0.74
R0633:Impg1	UTSW	9	80394155	missense	possibly damaging	0.72
R0705:Impg1	UTSW	9	80379979	missense	probably damaging	1.00
R0962:Impg1	UTSW	9	80381741	missense	probably benign	0.23
R1264:Impg1	UTSW	9	80314393	missense	probably benign	0.31
R1707:Impg1	UTSW	9	80378517	splice site	probably null
R2017:Impg1	UTSW	9	80440667	missense	probably damaging	1.00
R3904:Impg1	UTSW	9	80345585	missense	possibly damaging	0.76
R3960:Impg1	UTSW	9	80440864	missense	probably benign	0.00
R4231:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4235:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4236:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4490:Impg1	UTSW	9	80394059	missense	probably damaging	1.00
R4592:Impg1	UTSW	9	80440854	missense	probably benign	0.05
R4701:Impg1	UTSW	9	80314400	missense	probably benign	0.07
R4785:Impg1	UTSW	9	80398450	missense	probably benign	0.01
R4796:Impg1	UTSW	9	80394095	missense	probably damaging	0.99
R4923:Impg1	UTSW	9	80345078	nonsense	probably null
R4923:Impg1	UTSW	9	80345545	missense	probably damaging	0.98
R5468:Impg1	UTSW	9	80465265	missense	probably benign	0.05
R5596:Impg1	UTSW	9	80345218	missense	probably benign	0.24
R6001:Impg1	UTSW	9	80316172	missense	probably benign	0.12
R6156:Impg1	UTSW	9	80322824	missense	probably damaging	1.00
R6315:Impg1	UTSW	9	80394074	missense	probably benign	0.21
R6419:Impg1	UTSW	9	80380018	missense	probably benign	0.38
R6880:Impg1	UTSW	9	80404800	missense	probably damaging	1.00
R7013:Impg1	UTSW	9	80378494	missense	probably damaging	1.00
R8542:Impg1	UTSW	9	80404798	missense	probably damaging	1.00
R9018:Impg1	UTSW	9	80394192	missense	probably benign	0.19
R9034:Impg1	UTSW	9	80465298	start gained	probably benign
R9174:Impg1	UTSW	9	80345468	missense	probably damaging	0.99
R9242:Impg1	UTSW	9	80381782	missense	probably damaging	1.00
R9344:Impg1	UTSW	9	80404758	missense	probably benign	0.39
R9380:Impg1	UTSW	9	80381795	missense	probably benign	0.34
Z1176:Impg1	UTSW	9	80378467	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- AATACCACTAGCTCCTGGCC -3'
(R):5'- CAGCCTCAATTTCCCGATCAG -3'

Sequencing Primer
(F):5'- CCCTTGGTGGCAATGGTCTC -3'
(R):5'- TTCCCGATCAGAAAATCTACCTTCG -3'

Posted On

2015-06-12