Incidental Mutation 'R4233:Slc13a2'
List |< first << previous [record 42 of 50] next >> last >|
ID320973
Institutional Source Beutler Lab
Gene Symbol Slc13a2
Ensembl Gene ENSMUSG00000001095
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2
Synonymssodium/dicarboxylate co-transporter, Nadc1, mNaDC-1
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78397087-78422217 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 78403535 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001122]
Predicted Effect probably benign
Transcript: ENSMUST00000001122
SMART Domains Protein: ENSMUSP00000001122
Gene: ENSMUSG00000001095

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 6 560 7.1e-161 PFAM
Pfam:CitMHS 45 164 3e-15 PFAM
Pfam:CitMHS 203 499 1.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149865
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-coupled citrate transporter that is regulated by the chaperone activity of cyclophilin b. The encoded protein may play a role in the formation of kidney stones. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased Kreb cycle intermediates in the urine but otherwise have normal kidney function and response to ischemia-reperfusion injury and caloric restriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Slc13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Slc13a2 APN 11 78400548 missense probably damaging 1.00
IGL01604:Slc13a2 APN 11 78403395 missense possibly damaging 0.82
IGL01679:Slc13a2 APN 11 78404711 missense probably damaging 1.00
IGL03100:Slc13a2 APN 11 78404473 missense probably damaging 1.00
IGL03380:Slc13a2 APN 11 78399082 missense probably benign 0.03
deliberate UTSW 11 78403480 critical splice acceptor site probably benign
Familiaris UTSW 11 78404795 missense probably damaging 1.00
intentional UTSW 11 78404708 missense probably damaging 1.00
R0085:Slc13a2 UTSW 11 78406868 missense probably damaging 0.96
R0324:Slc13a2 UTSW 11 78404524 missense probably damaging 1.00
R0368:Slc13a2 UTSW 11 78404800 nonsense probably null
R0440:Slc13a2 UTSW 11 78403175 missense probably benign 0.05
R0539:Slc13a2 UTSW 11 78399138 missense probably damaging 1.00
R1519:Slc13a2 UTSW 11 78397746 missense possibly damaging 0.59
R1550:Slc13a2 UTSW 11 78403164 missense probably damaging 1.00
R1909:Slc13a2 UTSW 11 78400142 missense possibly damaging 0.90
R2166:Slc13a2 UTSW 11 78403075 missense probably benign 0.16
R2994:Slc13a2 UTSW 11 78404737 missense probably damaging 1.00
R2998:Slc13a2 UTSW 11 78404785 missense probably damaging 0.99
R3418:Slc13a2 UTSW 11 78400840 missense probably benign 0.05
R3932:Slc13a2 UTSW 11 78398400 missense probably damaging 1.00
R4462:Slc13a2 UTSW 11 78404387 missense probably benign 0.44
R5014:Slc13a2 UTSW 11 78400161 missense possibly damaging 0.73
R5170:Slc13a2 UTSW 11 78400808 missense probably damaging 1.00
R5484:Slc13a2 UTSW 11 78404822 splice site probably benign
R5809:Slc13a2 UTSW 11 78397821 missense probably damaging 1.00
R5973:Slc13a2 UTSW 11 78400532 missense probably damaging 0.99
R6243:Slc13a2 UTSW 11 78404708 missense probably damaging 1.00
R6263:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6275:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6276:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6279:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6280:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6300:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6305:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6314:Slc13a2 UTSW 11 78403480 critical splice acceptor site probably benign
R6673:Slc13a2 UTSW 11 78397831 missense probably benign 0.12
R7138:Slc13a2 UTSW 11 78399124 missense possibly damaging 0.76
R7382:Slc13a2 UTSW 11 78404795 missense probably damaging 1.00
R7657:Slc13a2 UTSW 11 78398397 missense probably damaging 0.99
R7791:Slc13a2 UTSW 11 78422064 critical splice donor site probably null
R8027:Slc13a2 UTSW 11 78404756 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCCATTTGTCACTCAGTGAG -3'
(R):5'- GTGCTAGGACCCTTCATTCC -3'

Sequencing Primer
(F):5'- AGAGTGCAAGCCCCCTTTTG -3'
(R):5'- TTCCCAGCAATCCAAGAGTTTG -3'
Posted On2015-06-12