Incidental Mutation 'R4233:Ryr2'
ID 320977
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 041642-MU
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Essential gene? Essential (E-score: 1.000) question?
Stock # R4233 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 11553102-12106945 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11750725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1375 (D1375G)
Ref Sequence ENSEMBL: ENSMUSP00000021750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000021750
AA Change: D1375G

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: D1375G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170156
AA Change: D1375G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: D1375G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221609
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 (GRCm38) Y96N probably damaging Het
Abca15 C T 7: 120,402,979 (GRCm38) Q1572* probably null Het
Ajuba T C 14: 54,569,526 (GRCm38) R490G probably damaging Het
Akap6 T A 12: 53,139,671 (GRCm38) N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 (GRCm38) probably null Het
Aph1c A G 9: 66,833,321 (GRCm38) F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 (GRCm38) V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 (GRCm38) I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 (GRCm38) V458A possibly damaging Het
Atg14 T C 14: 47,551,345 (GRCm38) K184E probably benign Het
Casp8 T C 1: 58,844,770 (GRCm38) V432A probably damaging Het
Ccar2 T C 14: 70,151,091 (GRCm38) T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 (GRCm38) V541M possibly damaging Het
Coro2b T C 9: 62,426,185 (GRCm38) E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 (GRCm38) T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 (GRCm38) E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 (GRCm38) probably benign Het
Fam160b2 A C 14: 70,586,878 (GRCm38) V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 (GRCm38) T135K possibly damaging Het
Fras1 A T 5: 96,714,376 (GRCm38) I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 (GRCm38) noncoding transcript Het
Gm26678 T C 3: 54,633,083 (GRCm38) noncoding transcript Het
Gm5108 C A 5: 67,975,153 (GRCm38) T55K unknown Het
Gpa33 A T 1: 166,146,771 (GRCm38) D59V probably damaging Het
Gpn2 T A 4: 133,584,705 (GRCm38) Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 (GRCm38) P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 (GRCm38) S124R possibly damaging Het
Impg1 A G 9: 80,345,329 (GRCm38) L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 (GRCm38) probably null Het
Madd T C 2: 91,178,236 (GRCm38) E107G probably benign Het
Med12l T G 3: 59,257,223 (GRCm38) probably null Het
Nxpe4 A T 9: 48,398,837 (GRCm38) T467S probably damaging Het
Olfr658 A G 7: 104,644,988 (GRCm38) V126A probably benign Het
Olfr849 T A 9: 19,441,590 (GRCm38) L226I probably damaging Het
Pam A T 1: 97,864,394 (GRCm38) V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 (GRCm38) N1257D probably benign Het
Prkdc C T 16: 15,835,919 (GRCm38) A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 (GRCm38) R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 (GRCm38) C537R probably damaging Het
Skint11 C A 4: 114,244,659 (GRCm38) Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 (GRCm38) probably benign Het
Slc7a13 T C 4: 19,819,070 (GRCm38) F90S probably damaging Het
Spc24 T C 9: 21,756,202 (GRCm38) probably null Het
Stard13 A G 5: 151,062,699 (GRCm38) S331P probably benign Het
Sult2a8 T A 7: 14,413,683 (GRCm38) I228L probably benign Het
Tas2r140 A T 6: 133,054,952 (GRCm38) V281D probably damaging Het
Tmem38b T C 4: 53,840,710 (GRCm38) C66R probably damaging Het
Tshz1 C A 18: 84,016,195 (GRCm38) E29D probably benign Het
Zfp599 T A 9: 22,249,745 (GRCm38) K375* probably null Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,834,092 (GRCm38) splice site probably benign
IGL00757:Ryr2 APN 13 11,618,604 (GRCm38) splice site probably null
IGL00838:Ryr2 APN 13 11,568,503 (GRCm38) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,585,478 (GRCm38) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,735,502 (GRCm38) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,703,544 (GRCm38) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,638,485 (GRCm38) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,587,239 (GRCm38) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,556,685 (GRCm38) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,591,352 (GRCm38) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,742,036 (GRCm38) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,799,837 (GRCm38) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,851,204 (GRCm38) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,721,790 (GRCm38) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,721,761 (GRCm38) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,601,758 (GRCm38) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,591,316 (GRCm38) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,594,968 (GRCm38) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,692,677 (GRCm38) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,585,480 (GRCm38) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,601,842 (GRCm38) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,595,425 (GRCm38) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,554,550 (GRCm38) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,790,363 (GRCm38) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,597,112 (GRCm38) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,747,564 (GRCm38) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,572,257 (GRCm38) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,792,762 (GRCm38) nonsense probably null
IGL02086:Ryr2 APN 13 11,735,556 (GRCm38) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,759,759 (GRCm38) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,737,873 (GRCm38) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,741,869 (GRCm38) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,730,388 (GRCm38) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,747,658 (GRCm38) splice site probably benign
IGL02369:Ryr2 APN 13 11,619,496 (GRCm38) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,722,721 (GRCm38) splice site probably benign
IGL02400:Ryr2 APN 13 11,605,244 (GRCm38) splice site probably benign
IGL02423:Ryr2 APN 13 11,745,198 (GRCm38) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,745,674 (GRCm38) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,705,699 (GRCm38) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,554,511 (GRCm38) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,605,189 (GRCm38) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,738,320 (GRCm38) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,655,677 (GRCm38) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,595,190 (GRCm38) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,707,793 (GRCm38) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,918,319 (GRCm38) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,591,269 (GRCm38) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,759,835 (GRCm38) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,684,479 (GRCm38) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,643,902 (GRCm38) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,635,582 (GRCm38) splice site probably benign
IGL03152:Ryr2 APN 13 11,853,150 (GRCm38) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,742,023 (GRCm38) nonsense probably null
IGL03180:Ryr2 APN 13 11,568,563 (GRCm38) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,724,387 (GRCm38) splice site probably benign
IGL03390:Ryr2 APN 13 11,772,416 (GRCm38) missense probably benign
IGL03410:Ryr2 APN 13 11,588,147 (GRCm38) missense probably damaging 0.99
Arruda UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
Arruda2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
Arruda3 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
barricuda UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB006:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
BB016:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,717,141 (GRCm38) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,665,962 (GRCm38) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,761,306 (GRCm38) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,707,796 (GRCm38) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,594,755 (GRCm38) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,555,448 (GRCm38) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,824,379 (GRCm38) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,665,919 (GRCm38) missense probably benign
R0018:Ryr2 UTSW 13 11,595,223 (GRCm38) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,595,784 (GRCm38) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,669,038 (GRCm38) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,869,116 (GRCm38) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,568,475 (GRCm38) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,709,921 (GRCm38) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,714,548 (GRCm38) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,676,251 (GRCm38) splice site probably benign
R0226:Ryr2 UTSW 13 11,772,556 (GRCm38) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,716,977 (GRCm38) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,668,839 (GRCm38) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,705,684 (GRCm38) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,834,095 (GRCm38) splice site probably benign
R0558:Ryr2 UTSW 13 11,799,861 (GRCm38) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,638,443 (GRCm38) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,731,669 (GRCm38) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,635,559 (GRCm38) missense probably null
R0601:Ryr2 UTSW 13 11,705,633 (GRCm38) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,622,952 (GRCm38) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,724,333 (GRCm38) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,566,885 (GRCm38) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,738,126 (GRCm38) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,554,529 (GRCm38) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,669,969 (GRCm38) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,945,981 (GRCm38) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,660,113 (GRCm38) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,883,043 (GRCm38) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,687,879 (GRCm38) splice site probably benign
R1400:Ryr2 UTSW 13 11,595,076 (GRCm38) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,714,503 (GRCm38) splice site probably benign
R1443:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,738,149 (GRCm38) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,727,022 (GRCm38) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,601,841 (GRCm38) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,554,592 (GRCm38) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,554,549 (GRCm38) nonsense probably null
R1551:Ryr2 UTSW 13 11,785,143 (GRCm38) critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11,759,677 (GRCm38) missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11,794,563 (GRCm38) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,718,482 (GRCm38) nonsense probably null
R1686:Ryr2 UTSW 13 11,603,779 (GRCm38) splice site probably benign
R1696:Ryr2 UTSW 13 11,731,657 (GRCm38) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,587,442 (GRCm38) splice site probably null
R1728:Ryr2 UTSW 13 11,587,422 (GRCm38) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,790,267 (GRCm38) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,745,176 (GRCm38) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,700,371 (GRCm38) nonsense probably null
R1801:Ryr2 UTSW 13 11,595,281 (GRCm38) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,560,586 (GRCm38) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,587,316 (GRCm38) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,769,878 (GRCm38) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,731,700 (GRCm38) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,662,075 (GRCm38) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,738,356 (GRCm38) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,658,958 (GRCm38) nonsense probably null
R1897:Ryr2 UTSW 13 11,750,932 (GRCm38) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,591,336 (GRCm38) missense probably benign
R1909:Ryr2 UTSW 13 11,700,349 (GRCm38) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,556,698 (GRCm38) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,731,723 (GRCm38) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,681,080 (GRCm38) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,585,402 (GRCm38) splice site probably null
R2018:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,851,188 (GRCm38) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,595,736 (GRCm38) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,665,878 (GRCm38) splice site probably null
R2088:Ryr2 UTSW 13 11,662,229 (GRCm38) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,945,977 (GRCm38) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,712,195 (GRCm38) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,560,607 (GRCm38) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,577,873 (GRCm38) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,705,793 (GRCm38) nonsense probably null
R2207:Ryr2 UTSW 13 11,810,937 (GRCm38) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,662,260 (GRCm38) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,738,216 (GRCm38) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,738,242 (GRCm38) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,591,237 (GRCm38) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,801,848 (GRCm38) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,759,703 (GRCm38) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,593,093 (GRCm38) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,761,349 (GRCm38) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,772,580 (GRCm38) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,588,159 (GRCm38) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,738,209 (GRCm38) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,772,427 (GRCm38) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,918,414 (GRCm38) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,692,682 (GRCm38) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,779,267 (GRCm38) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,587,437 (GRCm38) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,737,873 (GRCm38) missense possibly damaging 0.92
R4355:Ryr2 UTSW 13 11,649,812 (GRCm38) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,605,233 (GRCm38) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,717,066 (GRCm38) nonsense probably null
R4430:Ryr2 UTSW 13 11,735,527 (GRCm38) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,106,415 (GRCm38) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,749,509 (GRCm38) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,750,685 (GRCm38) splice site probably null
R4668:Ryr2 UTSW 13 11,593,117 (GRCm38) missense probably benign
R4677:Ryr2 UTSW 13 11,706,667 (GRCm38) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,824,369 (GRCm38) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,595,233 (GRCm38) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,692,646 (GRCm38) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,716,998 (GRCm38) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,577,909 (GRCm38) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,737,753 (GRCm38) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,657,047 (GRCm38) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,687,932 (GRCm38) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,708,227 (GRCm38) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,717,097 (GRCm38) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,655,698 (GRCm38) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,745,752 (GRCm38) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,668,820 (GRCm38) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,752,218 (GRCm38) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,594,986 (GRCm38) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,709,963 (GRCm38) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,945,945 (GRCm38) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,742,011 (GRCm38) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,785,080 (GRCm38) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,714,611 (GRCm38) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,833,992 (GRCm38) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,595,306 (GRCm38) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,643,895 (GRCm38) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,587,254 (GRCm38) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,635,536 (GRCm38) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,700,354 (GRCm38) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,712,243 (GRCm38) nonsense probably null
R5135:Ryr2 UTSW 13 11,662,130 (GRCm38) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,660,289 (GRCm38) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,752,321 (GRCm38) missense probably benign
R5187:Ryr2 UTSW 13 11,772,452 (GRCm38) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,638,430 (GRCm38) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,772,437 (GRCm38) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,690,363 (GRCm38) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,556,658 (GRCm38) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,705,656 (GRCm38) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,705,701 (GRCm38) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,687,909 (GRCm38) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,555,448 (GRCm38) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,595,014 (GRCm38) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,708,202 (GRCm38) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,601,805 (GRCm38) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,595,582 (GRCm38) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,759,836 (GRCm38) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,769,962 (GRCm38) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,560,574 (GRCm38) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,584,154 (GRCm38) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,790,332 (GRCm38) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,687,902 (GRCm38) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,660,122 (GRCm38) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,726,953 (GRCm38) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,662,238 (GRCm38) nonsense probably null
R5974:Ryr2 UTSW 13 11,714,511 (GRCm38) splice site probably null
R6104:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,792,689 (GRCm38) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,669,017 (GRCm38) missense probably benign
R6208:Ryr2 UTSW 13 11,895,220 (GRCm38) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,834,078 (GRCm38) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,660,107 (GRCm38) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,879,496 (GRCm38) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,761,396 (GRCm38) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,662,383 (GRCm38) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,834,007 (GRCm38) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,668,821 (GRCm38) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,710,065 (GRCm38) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,595,643 (GRCm38) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,594,723 (GRCm38) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,738,462 (GRCm38) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,686,966 (GRCm38) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,726,930 (GRCm38) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,829,654 (GRCm38) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,827,559 (GRCm38) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,745,601 (GRCm38) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,566,948 (GRCm38) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,801,243 (GRCm38) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,654,380 (GRCm38) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,712,166 (GRCm38) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,794,605 (GRCm38) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,824,400 (GRCm38) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,649,776 (GRCm38) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,669,987 (GRCm38) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,655,713 (GRCm38) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,668,811 (GRCm38) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,640,327 (GRCm38) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,810,908 (GRCm38) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,801,177 (GRCm38) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,686,978 (GRCm38) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,759,757 (GRCm38) missense probably benign
R7189:Ryr2 UTSW 13 11,883,123 (GRCm38) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,665,913 (GRCm38) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,597,146 (GRCm38) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,738,194 (GRCm38) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,745,631 (GRCm38) missense probably benign
R7365:Ryr2 UTSW 13 11,640,275 (GRCm38) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,680,999 (GRCm38) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,785,111 (GRCm38) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,735,620 (GRCm38) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,556,748 (GRCm38) splice site probably null
R7425:Ryr2 UTSW 13 11,705,644 (GRCm38) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,555,463 (GRCm38) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,752,282 (GRCm38) missense probably benign
R7460:Ryr2 UTSW 13 11,705,710 (GRCm38) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,594,876 (GRCm38) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,638,431 (GRCm38) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,737,985 (GRCm38) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,799,825 (GRCm38) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,560,653 (GRCm38) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,761,327 (GRCm38) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,761,315 (GRCm38) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,690,333 (GRCm38) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,730,343 (GRCm38) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,751,011 (GRCm38) missense probably benign
R7797:Ryr2 UTSW 13 11,801,180 (GRCm38) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,827,607 (GRCm38) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,706,623 (GRCm38) nonsense probably null
R7872:Ryr2 UTSW 13 11,595,724 (GRCm38) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,792,748 (GRCm38) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,594,794 (GRCm38) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,690,295 (GRCm38) nonsense probably null
R7952:Ryr2 UTSW 13 11,646,427 (GRCm38) splice site probably null
R8008:Ryr2 UTSW 13 11,657,094 (GRCm38) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,588,140 (GRCm38) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,945,995 (GRCm38) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,603,698 (GRCm38) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,827,553 (GRCm38) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,595,506 (GRCm38) nonsense probably null
R8351:Ryr2 UTSW 13 11,799,832 (GRCm38) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,668,935 (GRCm38) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,684,478 (GRCm38) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,659,008 (GRCm38) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,577,778 (GRCm38) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,560,593 (GRCm38) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,687,989 (GRCm38) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,686,947 (GRCm38) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,668,969 (GRCm38) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,735,623 (GRCm38) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,558,048 (GRCm38) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,779,266 (GRCm38) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,785,104 (GRCm38) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,799,882 (GRCm38) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,595,038 (GRCm38) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,603,732 (GRCm38) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,594,786 (GRCm38) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,738,103 (GRCm38) nonsense probably null
R9056:Ryr2 UTSW 13 11,595,931 (GRCm38) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,601,838 (GRCm38) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,603,855 (GRCm38) intron probably benign
R9116:Ryr2 UTSW 13 11,572,299 (GRCm38) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,654,406 (GRCm38) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,885,538 (GRCm38) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,829,674 (GRCm38) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,595,886 (GRCm38) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,750,968 (GRCm38) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,883,090 (GRCm38) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,706,692 (GRCm38) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,883,116 (GRCm38) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,681,087 (GRCm38) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,794,573 (GRCm38) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,772,577 (GRCm38) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,737,794 (GRCm38) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,556,604 (GRCm38) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,587,215 (GRCm38) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,745,218 (GRCm38) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,668,962 (GRCm38) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,722,760 (GRCm38) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,687,049 (GRCm38) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,594,899 (GRCm38) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,692,713 (GRCm38) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,869,156 (GRCm38) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,703,501 (GRCm38) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,643,803 (GRCm38) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,598,611 (GRCm38) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,794,549 (GRCm38) nonsense probably null
Z1177:Ryr2 UTSW 13 11,750,873 (GRCm38) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGCATACTGTAGTTGAGCATTCACA -3'
(R):5'- CTCAAAGTCGGTGGCGGG -3'

Sequencing Primer
(F):5'- CAGAATTGGCAAGCTCTAGGTTCC -3'
(R):5'- GGAGGGCTTCCTGGTGC -3'
Posted On 2015-06-12