Incidental Mutation 'R4233:Fbxo32'
ID320984
Institutional Source Beutler Lab
Gene Symbol Fbxo32
Ensembl Gene ENSMUSG00000022358
Gene NameF-box protein 32
Synonyms4833442G10Rik, atrogin-1, MAFbx, ATROGIN1
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58175879-58214932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58192333 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 135 (T135K)
Ref Sequence ENSEMBL: ENSMUSP00000022986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022986]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022986
AA Change: T135K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022986
Gene: ENSMUSG00000022358
AA Change: T135K

DomainStartEndE-ValueType
Blast:FBOX 228 269 6e-16 BLAST
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and contains an F-box domain. This protein is highly expressed during muscle atrophy, whereas mice deficient in this gene were found to be resistant to atrophy. This protein is thus a potential drug target for the treatment of muscle atrophy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Fbxo32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Fbxo32 APN 15 58184236 missense probably damaging 0.98
IGL02371:Fbxo32 APN 15 58181464 utr 3 prime probably benign
IGL02721:Fbxo32 APN 15 58182962 missense possibly damaging 0.85
R0277:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R0323:Fbxo32 UTSW 15 58184209 missense probably damaging 1.00
R1661:Fbxo32 UTSW 15 58191469 missense probably damaging 1.00
R2315:Fbxo32 UTSW 15 58208035 missense probably benign 0.28
R2321:Fbxo32 UTSW 15 58191293 missense possibly damaging 0.52
R2849:Fbxo32 UTSW 15 58207972 missense probably benign
R4569:Fbxo32 UTSW 15 58181477 missense probably damaging 0.99
R6856:Fbxo32 UTSW 15 58214641 start gained probably benign
R7747:Fbxo32 UTSW 15 58191361 missense probably damaging 1.00
R7868:Fbxo32 UTSW 15 58214590 missense probably damaging 1.00
R8317:Fbxo32 UTSW 15 58205230 missense probably damaging 1.00
Z1176:Fbxo32 UTSW 15 58205242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGACTCACTTCTCTAGGC -3'
(R):5'- GAGCATCTGCCTTTTATTGCCTAG -3'

Sequencing Primer
(F):5'- AGGCTTATACTCCTTTAAACCTAGTG -3'
(R):5'- TCTAAGCCTGGCAACTTC -3'
Posted On2015-06-12