Mutagenetix > Incidental Mutations

Incidental Mutation 'R4233:Tshz1'

320987

Institutional Source

Beutler Lab

Gene Symbol

Tshz1

Ensembl Gene

ENSMUSG00000046982

Gene Name

teashirt zinc finger family member 1

Synonyms

Mtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik

MMRRC Submission

041642-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4233 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84011627-84086404 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 84016195 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 29 (E29D)

Ref Sequence

ENSEMBL: ENSMUSP00000089388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060303]

Predicted Effect

probably benign
Transcript: ENSMUST00000060303
AA Change: E29D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: E29D

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
low complexity region	89	100	N/A	INTRINSIC
low complexity region	153	195	N/A	INTRINSIC
ZnF_C2H2	246	270	1.86e0	SMART
ZnF_C2H2	307	331	3.83e-2	SMART
ZnF_C2H2	416	440	5.34e0	SMART
low complexity region	497	515	N/A	INTRINSIC
HOX	890	964	4.15e-4	SMART
ZnF_C2H2	976	998	4.34e-1	SMART
ZnF_C2H2	1044	1067	4.47e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175783

SMART Domains

Protein: ENSMUSP00000135640
Gene: ENSMUSG00000046982

Domain	Start	End	E-Value	Type
ZnF_C2H2	43	67	1.7e-4	SMART
ZnF_C2H2	152	176	2.3e-2	SMART
low complexity region	233	251	N/A	INTRINSIC
HOX	626	700	2.1e-6	SMART
ZnF_C2H2	712	734	1.9e-3	SMART
ZnF_C2H2	780	803	1.8e-5	SMART

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,564,192	Y96N	probably damaging	Het
Abca15	C	T	7: 120,402,979	Q1572*	probably null	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aph1c	A	G	9: 66,833,321	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Arhgef40	T	C	14: 51,990,171	V458A	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Ccar2	T	C	14: 70,151,091	T169A	possibly damaging	Het
Cfap58	G	A	19: 47,975,555	V541M	possibly damaging	Het
Coro2b	T	C	9: 62,426,185	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,916,791	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360	E1549G	probably benign	Het
Ercc6l2	T	C	13: 63,872,168		probably benign	Het
Fam160b2	A	C	14: 70,586,878	V473G	probably damaging	Het
Fbxo32	G	T	15: 58,192,333	T135K	possibly damaging	Het
Fras1	A	T	5: 96,714,376	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,446,785		noncoding transcript	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Gm5108	C	A	5: 67,975,153	T55K	unknown	Het
Gpa33	A	T	1: 166,146,771	D59V	probably damaging	Het
Gpn2	T	A	4: 133,584,705	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,686,533	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,936,533	S124R	possibly damaging	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ldlrap1	T	A	4: 134,757,338		probably null	Het
Madd	T	C	2: 91,178,236	E107G	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr658	A	G	7: 104,644,988	V126A	probably benign	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	T	1: 97,864,394	V434D	possibly damaging	Het
Plxnd1	T	C	6: 115,965,953	N1257D	probably benign	Het
Prkdc	C	T	16: 15,835,919	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	T	C	13: 11,750,725	D1375G	probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,403,535		probably benign	Het
Slc7a13	T	C	4: 19,819,070	F90S	probably damaging	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Stard13	A	G	5: 151,062,699	S331P	probably benign	Het
Sult2a8	T	A	7: 14,413,683	I228L	probably benign	Het
Tas2r140	A	T	6: 133,054,952	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Tshz1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01486:Tshz1	APN	18	84013509	missense	possibly damaging	0.94
IGL02934:Tshz1	APN	18	84013090	missense	probably damaging	1.00
ANU18:Tshz1	UTSW	18	84014661	missense	probably damaging	1.00
PIT4810001:Tshz1	UTSW	18	84013250	missense	possibly damaging	0.85
R0052:Tshz1	UTSW	18	84014945	missense	possibly damaging	0.76
R0052:Tshz1	UTSW	18	84014945	missense	possibly damaging	0.76
R0364:Tshz1	UTSW	18	84016124	missense	probably benign	0.31
R0391:Tshz1	UTSW	18	84016049	missense	possibly damaging	0.93
R0515:Tshz1	UTSW	18	84015965	missense	probably benign
R0942:Tshz1	UTSW	18	84013053	missense	probably damaging	0.99
R0943:Tshz1	UTSW	18	84015231	missense	probably benign	0.04
R1472:Tshz1	UTSW	18	84013805	missense	possibly damaging	0.93
R1895:Tshz1	UTSW	18	84013433	missense	probably damaging	1.00
R2022:Tshz1	UTSW	18	84013862	missense	probably damaging	0.98
R2860:Tshz1	UTSW	18	84014980	missense	probably damaging	1.00
R2861:Tshz1	UTSW	18	84014980	missense	probably damaging	1.00
R4027:Tshz1	UTSW	18	84014829	missense	possibly damaging	0.74
R4028:Tshz1	UTSW	18	84014829	missense	possibly damaging	0.74
R4030:Tshz1	UTSW	18	84014829	missense	possibly damaging	0.74
R4031:Tshz1	UTSW	18	84014829	missense	possibly damaging	0.74
R4119:Tshz1	UTSW	18	84014189	missense	probably benign	0.00
R4573:Tshz1	UTSW	18	84015082	missense	probably damaging	1.00
R4604:Tshz1	UTSW	18	84013374	missense	probably damaging	1.00
R4960:Tshz1	UTSW	18	84014862	missense	probably benign	0.08
R5085:Tshz1	UTSW	18	84013928	missense	probably benign	0.01
R5124:Tshz1	UTSW	18	84015467	missense	probably damaging	1.00
R5150:Tshz1	UTSW	18	84013215	nonsense	probably null
R5357:Tshz1	UTSW	18	84015080	missense	probably damaging	1.00
R5530:Tshz1	UTSW	18	84013268	missense	probably damaging	1.00
R5718:Tshz1	UTSW	18	84014524	missense	probably damaging	1.00
R5750:Tshz1	UTSW	18	84013961	missense	possibly damaging	0.93
R5778:Tshz1	UTSW	18	84015680	missense	probably damaging	1.00
R6052:Tshz1	UTSW	18	84014069	missense	probably damaging	1.00
R6279:Tshz1	UTSW	18	84015311	missense	probably damaging	1.00
R6393:Tshz1	UTSW	18	84013220	missense	probably damaging	1.00
R6407:Tshz1	UTSW	18	84015966	missense	possibly damaging	0.55
R6425:Tshz1	UTSW	18	84015563	missense	probably damaging	0.99
R6998:Tshz1	UTSW	18	84015841	missense	probably benign	0.00
R7165:Tshz1	UTSW	18	84015927	missense	probably damaging	1.00
R7233:Tshz1	UTSW	18	84014819	missense	possibly damaging	0.63
R7330:Tshz1	UTSW	18	84014831	missense	probably damaging	0.96
R7491:Tshz1	UTSW	18	84015641	missense	probably damaging	1.00
R7579:Tshz1	UTSW	18	84014665	nonsense	probably null
R7592:Tshz1	UTSW	18	84014048	missense	probably damaging	1.00
R7659:Tshz1	UTSW	18	84016075	missense	probably damaging	0.97
R7702:Tshz1	UTSW	18	84014336	missense	probably damaging	1.00
R7844:Tshz1	UTSW	18	84014171	missense	probably benign	0.00
R7908:Tshz1	UTSW	18	84014607	nonsense	probably null
R7927:Tshz1	UTSW	18	84014171	missense	probably benign	0.00
R7989:Tshz1	UTSW	18	84014607	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTGAAATGGGCCAGCTGGTC -3'
(R):5'- GCCTCAGTGTGGCTTATTCC -3'

Sequencing Primer
(F):5'- TGGTCACTGCCCTCACTGAAG -3'
(R):5'- TTGCCCATGTCCAGTGGG -3'

Posted On

2015-06-12