Mutagenetix > Incidental Mutations

Incidental Mutation 'R4233:Cfap58'

320988

Institutional Source

Beutler Lab

Gene Symbol

Cfap58

Ensembl Gene

ENSMUSG00000046585

Gene Name

cilia and flagella associated protein 58

Synonyms

LOC381229, Ccdc147

MMRRC Submission

041642-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R4233 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47937712-48035379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47975555 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 541 (V541M)

Ref Sequence

ENSEMBL: ENSMUSP00000070533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066308]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066308
AA Change: V541M

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: V541M

Domain	Start	End	E-Value	Type
coiled coil region	106	579	N/A	INTRINSIC
coiled coil region	642	706	N/A	INTRINSIC
low complexity region	740	762	N/A	INTRINSIC
coiled coil region	772	832	N/A	INTRINSIC

Meta Mutation Damage Score

0.0927

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,564,192	Y96N	probably damaging	Het
Abca15	C	T	7: 120,402,979	Q1572*	probably null	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Aph1c	A	G	9: 66,833,321	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Arhgef40	T	C	14: 51,990,171	V458A	possibly damaging	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
Casp8	T	C	1: 58,844,770	V432A	probably damaging	Het
Ccar2	T	C	14: 70,151,091	T169A	possibly damaging	Het
Coro2b	T	C	9: 62,426,185	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,916,791	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360	E1549G	probably benign	Het
Ercc6l2	T	C	13: 63,872,168		probably benign	Het
Fam160b2	A	C	14: 70,586,878	V473G	probably damaging	Het
Fbxo32	G	T	15: 58,192,333	T135K	possibly damaging	Het
Fras1	A	T	5: 96,714,376	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,446,785		noncoding transcript	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Gm5108	C	A	5: 67,975,153	T55K	unknown	Het
Gpa33	A	T	1: 166,146,771	D59V	probably damaging	Het
Gpn2	T	A	4: 133,584,705	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,686,533	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,936,533	S124R	possibly damaging	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ldlrap1	T	A	4: 134,757,338		probably null	Het
Madd	T	C	2: 91,178,236	E107G	probably benign	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Nxpe4	A	T	9: 48,398,837	T467S	probably damaging	Het
Olfr658	A	G	7: 104,644,988	V126A	probably benign	Het
Olfr849	T	A	9: 19,441,590	L226I	probably damaging	Het
Pam	A	T	1: 97,864,394	V434D	possibly damaging	Het
Plxnd1	T	C	6: 115,965,953	N1257D	probably benign	Het
Prkdc	C	T	16: 15,835,919	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr2	T	C	13: 11,750,725	D1375G	probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,403,535		probably benign	Het
Slc7a13	T	C	4: 19,819,070	F90S	probably damaging	Het
Spc24	T	C	9: 21,756,202		probably null	Het
Stard13	A	G	5: 151,062,699	S331P	probably benign	Het
Sult2a8	T	A	7: 14,413,683	I228L	probably benign	Het
Tas2r140	A	T	6: 133,054,952	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tshz1	C	A	18: 84,016,195	E29D	probably benign	Het
Zfp599	T	A	9: 22,249,745	K375*	probably null	Het

Other mutations in Cfap58

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01688:Cfap58	APN	19	47974567	missense	probably benign	0.30
IGL02068:Cfap58	APN	19	47986512	missense	probably damaging	1.00
IGL02609:Cfap58	APN	19	47975502	missense	possibly damaging	0.80
IGL03376:Cfap58	APN	19	48034725	missense	possibly damaging	0.60
PIT4515001:Cfap58	UTSW	19	48034683	missense	probably benign
PIT4618001:Cfap58	UTSW	19	47975514	missense	probably damaging	1.00
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0454:Cfap58	UTSW	19	47974680	critical splice donor site	probably null
R0545:Cfap58	UTSW	19	47941097	splice site	probably benign
R0789:Cfap58	UTSW	19	47955309	missense	probably benign	0.09
R0926:Cfap58	UTSW	19	47962562	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1493:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1541:Cfap58	UTSW	19	47983530	missense	probably damaging	1.00
R1629:Cfap58	UTSW	19	47941339	missense	probably benign	0.02
R1648:Cfap58	UTSW	19	47955405	missense	probably benign	0.13
R1837:Cfap58	UTSW	19	48029139	missense	probably damaging	0.98
R2307:Cfap58	UTSW	19	47962486	nonsense	probably null
R2513:Cfap58	UTSW	19	47962542	missense	probably benign	0.03
R3802:Cfap58	UTSW	19	47953059	missense	possibly damaging	0.81
R4258:Cfap58	UTSW	19	47949484	splice site	probably null
R4414:Cfap58	UTSW	19	47953041	missense	possibly damaging	0.87
R4763:Cfap58	UTSW	19	47983506	missense	probably damaging	1.00
R5300:Cfap58	UTSW	19	47941156	missense	probably benign	0.09
R5406:Cfap58	UTSW	19	48029102	missense	possibly damaging	0.81
R5497:Cfap58	UTSW	19	48029109	missense	probably benign	0.08
R5635:Cfap58	UTSW	19	47983542	missense	possibly damaging	0.47
R6315:Cfap58	UTSW	19	47941277	missense	probably benign	0.40
R6483:Cfap58	UTSW	19	47983452	missense	probably benign	0.00
R6727:Cfap58	UTSW	19	47955417	missense	probably benign	0.30
R6896:Cfap58	UTSW	19	47944187	missense	probably damaging	0.98
R7461:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7473:Cfap58	UTSW	19	47974625	nonsense	probably null
R7613:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7650:Cfap58	UTSW	19	47986528	missense	possibly damaging	0.84
X0067:Cfap58	UTSW	19	47955308	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCCAATTCCGTGCCATGTC -3'
(R):5'- TGAGACTTTGGGTCCCTTCC -3'

Sequencing Primer
(F):5'- CAATTCCGTGCCATGTCTATAAGG -3'
(R):5'- GACTTTGGGTCCCTTCCTTGGTC -3'

Posted On

2015-06-12