Incidental Mutation 'R4233:Cfap58'
List |< first << previous [record 13 of 50] next >> last >|
ID320988
Institutional Source Beutler Lab
Gene Symbol Cfap58
Ensembl Gene ENSMUSG00000046585
Gene Namecilia and flagella associated protein 58
SynonymsLOC381229, Ccdc147
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47937712-48035379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47975555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 541 (V541M)
Ref Sequence ENSEMBL: ENSMUSP00000070533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066308
AA Change: V541M

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: V541M

DomainStartEndE-ValueType
coiled coil region 106 579 N/A INTRINSIC
coiled coil region 642 706 N/A INTRINSIC
low complexity region 740 762 N/A INTRINSIC
coiled coil region 772 832 N/A INTRINSIC
Meta Mutation Damage Score 0.0927 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Cfap58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cfap58 APN 19 47974567 missense probably benign 0.30
IGL02068:Cfap58 APN 19 47986512 missense probably damaging 1.00
IGL02609:Cfap58 APN 19 47975502 missense possibly damaging 0.80
IGL03376:Cfap58 APN 19 48034725 missense possibly damaging 0.60
PIT4515001:Cfap58 UTSW 19 48034683 missense probably benign
PIT4618001:Cfap58 UTSW 19 47975514 missense probably damaging 1.00
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0454:Cfap58 UTSW 19 47974680 critical splice donor site probably null
R0545:Cfap58 UTSW 19 47941097 splice site probably benign
R0789:Cfap58 UTSW 19 47955309 missense probably benign 0.09
R0926:Cfap58 UTSW 19 47962562 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1493:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1541:Cfap58 UTSW 19 47983530 missense probably damaging 1.00
R1629:Cfap58 UTSW 19 47941339 missense probably benign 0.02
R1648:Cfap58 UTSW 19 47955405 missense probably benign 0.13
R1837:Cfap58 UTSW 19 48029139 missense probably damaging 0.98
R2307:Cfap58 UTSW 19 47962486 nonsense probably null
R2513:Cfap58 UTSW 19 47962542 missense probably benign 0.03
R3802:Cfap58 UTSW 19 47953059 missense possibly damaging 0.81
R4258:Cfap58 UTSW 19 47949484 splice site probably null
R4414:Cfap58 UTSW 19 47953041 missense possibly damaging 0.87
R4763:Cfap58 UTSW 19 47983506 missense probably damaging 1.00
R5300:Cfap58 UTSW 19 47941156 missense probably benign 0.09
R5406:Cfap58 UTSW 19 48029102 missense possibly damaging 0.81
R5497:Cfap58 UTSW 19 48029109 missense probably benign 0.08
R5635:Cfap58 UTSW 19 47983542 missense possibly damaging 0.47
R6315:Cfap58 UTSW 19 47941277 missense probably benign 0.40
R6483:Cfap58 UTSW 19 47983452 missense probably benign 0.00
R6727:Cfap58 UTSW 19 47955417 missense probably benign 0.30
R6896:Cfap58 UTSW 19 47944187 missense probably damaging 0.98
R7461:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7473:Cfap58 UTSW 19 47974625 nonsense probably null
R7613:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7650:Cfap58 UTSW 19 47986528 missense possibly damaging 0.84
R7982:Cfap58 UTSW 19 47974567 missense probably benign 0.30
R8083:Cfap58 UTSW 19 47983518 missense probably damaging 1.00
R8121:Cfap58 UTSW 19 48029104 missense probably benign 0.40
R8321:Cfap58 UTSW 19 47958147 missense probably damaging 0.99
R8396:Cfap58 UTSW 19 48029101 missense probably damaging 1.00
X0067:Cfap58 UTSW 19 47955308 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAATTCCGTGCCATGTC -3'
(R):5'- TGAGACTTTGGGTCCCTTCC -3'

Sequencing Primer
(F):5'- CAATTCCGTGCCATGTCTATAAGG -3'
(R):5'- GACTTTGGGTCCCTTCCTTGGTC -3'
Posted On2015-06-12